LOCUS       XM_048410743            3364 bp    mRNA    linear   INV 26-MAY-2022
DEFINITION  PREDICTED: Bombus terrestris copper-transporting ATPase 1
            (LOC100646432), transcript variant X13, mRNA.
ACCESSION   XM_048410743
VERSION     XM_048410743.1
DBLINK      BioProject: PRJNA839043
KEYWORDS    RefSeq.
SOURCE      Bombus terrestris (buff-tailed bumblebee)
  ORGANISM  Bombus terrestris
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Bombus; Bombus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_063280) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bombus terrestris Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3364
                     /organism="Bombus terrestris"
                     /mol_type="mRNA"
                     /db_xref="taxon:30195"
                     /chromosome="12"
     gene            1..3364
                     /gene="LOC100646432"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 23 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:100646432"
     CDS             16..3219
                     /gene="LOC100646432"
                     /codon_start=1
                     /product="copper-transporting ATPase 1 isoform X6"
                     /protein_id="XP_048266700.1"
                     /db_xref="GeneID:100646432"
                     /translation="

MKYPLPLCKVHKKLVANRSNFHYQSFPCLQFYDDNMIDENMKLLGDEEDDTDYEGTTQMVYVSRSQKMKDSTNTSTMKVNIDGMRCQSCVKNIEGTIGSRPEVLSVKVILEEKLGYVEYKAEEITPNELVEAIEDMGFTASLCSDESNAIEKIEKNDSLQSTISICTVHIDGMTCASCVKTIIDNLSEKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFIEEMGFNSFVKEVNGKVVGEETPMNLSLKNNSAQEELPLQMNGGGDVKIQNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVVFDPNKIRAIDIVSSISELGFPTTLIEESGTGEGDIELKITGMTCASCVNKIESTVKKLPGVHSATVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLITIDLVQRGDILKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPFVIVVSIVTLFVWIVVGYVNVNSLPISHNDQINKHGMNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSEATGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVTEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQSICRSVTFAQSC"

     misc_feature    247..438
                     /gene="LOC100646432"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(265..273,280..282)
                     /gene="LOC100646432"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    523..696
                     /gene="LOC100646432"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(532..540,547..549)
                     /gene="LOC100646432"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    856..1038
                     /gene="LOC100646432"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(865..873,880..882)
                     /gene="LOC100646432"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1075..1263
                     /gene="LOC100646432"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1093..1101,1108..1110)
                     /gene="LOC100646432"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1342..>3180
                     /gene="LOC100646432"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:451251"
ORIGIN      

attccatctagaacgatgaaatatcctttacctttgtgcaaagttcacaagaaattagtagcgaatcggtcaaatttccactatcagtcgtttccttgcttgcagttttacgacgacaatatgatcgatgagaatatgaaactacttggcgatgaggaggacgataccgattacgaaggcacgacacagatggtgtacgtttctcggtcgcagaaaatgaaagattccacgaatacttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagggaaccataggtagccgaccggaggttttaagcgttaaagtaatcctagaagagaagctcggttacgtcgaatataaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggattcactgcttccctatgcagcgacgaaagtaacgctatcgaaaagatagaaaaaaatgattcgttacaatcaactatcagtatttgtactgtacatattgatggaatgacttgtgcgtcttgtgttaagactatcattgacaatttatcggagaaagcaggaataaaacaggcgaacgttagtttagagaagaaggaagctacggtttcttataacgacaaggacctaacagctgaacaaatatcagggttcatcgaagaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttgtaggagaggaaacaccaatgaatttatcgttgaaaaacaattccgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagattcaaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgttgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtcgcattgatggcggccaaggcagaagttgtctttgatccgaataagataagggcgattgacatcgtttctagcatatcggaattgggcttccctactactttgatcgaagaatctggtactggagagggagatattgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaagaaattaccaggcgtccattctgccacagttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttagtaataaagataaagaaaacagagactacttggatcagagggaagaaataaacaagtggcggacagcttttttagtgtccttaatatttggcataccgtgtatgttagccatgacatactttatggtaatcatgtctattggtgaaaaaacgcacgaagatatgtgctgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtccagttttttggcggctggcatttttacgttcaagcatacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagctatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacctcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgagcgtttaatcactatagatttggtacaacgaggcgatatcttaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagtctaattaccggggaaagtatgccggtaccaaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaattactgccacgcatacaggagaacatacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctattcaacatttagccgataagatagctggttatttcataccttttgttatagttgtttctatagtaactttattcgtttggatagtagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaataaacacggaatgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcaatagcttgtccatgcgcgttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaagtgtattgtatttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagtttttagtcattatttgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcgctacgtgaaggaaacaataggctctgaagcaactgggcagtgcatgaattttcaagcagttgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaggtaaaaagattaccttctggaacgcataacttaaataatgtgtcaatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttactgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatatatactttgaaaaaaatgggtttagaagttattcttttaacaggagataataggaagactgctgtttctatcgctagacaaagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcaacgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgcaatatcttctggtacggatgttgctgttgaagctgccgatgtagtcctc

//