2024-05-18 14:49:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047801483 706 bp mRNA linear VRT 20-APR-2022 DEFINITION PREDICTED: Tachysurus fulvidraco histone H2B-like (LOC113653819), transcript variant X3, mRNA. ACCESSION XM_047801483 VERSION XM_047801483.1 DBLINK BioProject: PRJNA826113 KEYWORDS RefSeq. SOURCE Tachysurus fulvidraco (yellow catfish) ORGANISM Tachysurus fulvidraco Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes; Bagridae; Tachysurus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_062518) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Tachysurus fulvidraco Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..706 /organism="Tachysurus fulvidraco" /mol_type="mRNA" /isolate="hzauxx_2018" /db_xref="taxon:1234273" /chromosome="1" /sex="female" /tissue_type="muscle, blood" /dev_stage="adult" gene 1..706 /gene="LOC113653819" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 20 samples with support for all annotated introns" /db_xref="GeneID:113653819" CDS 186..461 /gene="LOC113653819" /codon_start=1 /product="histone H2B-like isoform X2" /protein_id="XP_047657439.1" /db_xref="GeneID:113653819" /translation="
MGITDSFVDDIVERIALESSCPPRHNNPATYKDIQTAVRLLLLGELRVALAAQQQEPLPQNFTSSAPLAADCSRTQPLKMNRYATKNTVAE"
misc_feature <186..323 /gene="LOC113653819" /note="Histone H2B; Region: H2B; cl23830" /db_xref="CDD:355063" ORIGIN
acacacatttgttctctttttcataattacaatgtcagactgtagccgctaggtgggtgttactcattctcgtgcagttcacttgcacagcaacaccatgtctgaaccagcgaagaccagccaagataacagcatgtaaaggcctgaagcaggtgcattctggtcccggtatctcctctaaggccatgggcatcacggactcgttcgtcgacgacattgttgagcgcatcgcccttgagtcttcttgtccgcctcgccacaacaaccccgccacctataaggacatccagactgccgtgcgtctgttgcttctcggagagttgagggtcgccctggcagctcagcagcaggagccgctgccacagaatttcacttcctctgctccacttgccgctgattgctccaggactcaacctctcaaaatgaataggtatgccaccaaaaacacggttgctgaatagaagtggtgaagcaagggtctcattctacctacccaaaccacattctcattttgctgacctcactgtgcatcgtcttgcaactgctcacgttcggtttttctttatttcatgggtgagcattgcagcattattgctttttcagtcataaaggtgtgtatatagcaacatacaagctttccatatatgttctggctgttaatgttttcagaaggaacatctgatttatggacttgcttgctttcttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]