GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 15:55:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_047801417             693 bp    mRNA    linear   VRT 20-APR-2022
DEFINITION  PREDICTED: Tachysurus fulvidraco histone H2B-like (LOC113653819),
            transcript variant X1, mRNA.
ACCESSION   XM_047801417
VERSION     XM_047801417.1
DBLINK      BioProject: PRJNA826113
KEYWORDS    RefSeq.
SOURCE      Tachysurus fulvidraco (yellow catfish)
  ORGANISM  Tachysurus fulvidraco
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes;
            Bagridae; Tachysurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_062518) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Tachysurus fulvidraco Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..693
                     /organism="Tachysurus fulvidraco"
                     /mol_type="mRNA"
                     /isolate="hzauxx_2018"
                     /db_xref="taxon:1234273"
                     /chromosome="1"
                     /sex="female"
                     /tissue_type="muscle, blood"
                     /dev_stage="adult"
     gene            1..693
                     /gene="LOC113653819"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 12 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:113653819"
     CDS             186..461
                     /gene="LOC113653819"
                     /codon_start=1
                     /product="histone H2B-like isoform X1"
                     /protein_id="XP_047657373.1"
                     /db_xref="GeneID:113653819"
                     /translation="
MGITDSFVDDIVERIALESSCPPRHNNPATYKDIQTAVRLLLLGELRVALAAQQQEPLPQNFTSSAPLAADCSRTQPLIMNRYATKNTVAE"
     misc_feature    <186..323
                     /gene="LOC113653819"
                     /note="Histone H2B; Region: H2B; cl23830"
                     /db_xref="CDD:355063"
ORIGIN      
acacacatttgttctctttttcataattacaatgtcagactgtagccgctaggtgggtgttactcattctcgtgcagttcacttgcacagcaacaccatgtctgaaccagcgaagaccagccaagataacagcatgtaaaggcctgaagcaggtgcattctggtcccggtatctcctctaaggccatgggcatcacggactcgttcgtcgacgacattgttgagcgcatcgcccttgagtcttcttgtccgcctcgccacaacaaccccgccacctataaggacatccagactgccgtgcgtctgttgcttctcggagagttgagggtcgccctggcagctcagcagcaggagccgctgccacagaatttcacttcctctgctccacttgccgctgattgctccaggactcaacctctcatcatgaataggtatgccaccaaaaacacggttgctgaatagaagtggtgaagcaagggtctcattctacctaaacaaactacattctcattttgctgacctcattgtgcatcttcttgcaactgctcacgttcggtttttctttatttcatggcacttaaagatctcaacaatgttgcaaatcacaggacgctggacaaattgaacaacataacgacggtccttgtaatccttgtcaccgtaataaacctgacaatcaaacctgacaaaccta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]