GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 11:22:38, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_047566734            3368 bp    mRNA    linear   ROD 04-MAR-2023
DEFINITION  PREDICTED: Sciurus carolinensis nuclear factor kappa B subunit 1
            (Nfkb1), transcript variant X5, mRNA.
ACCESSION   XM_047566734
VERSION     XM_047566734.1
DBLINK      BioProject: PRJNA823697
KEYWORDS    RefSeq.
SOURCE      Sciurus carolinensis (gray squirrel)
  ORGANISM  Sciurus carolinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Sciurinae; Sciurini; Sciurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_062222) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_902686445.1-RS_2023_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/03/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3368
                     /organism="Sciurus carolinensis"
                     /mol_type="mRNA"
                     /db_xref="taxon:30640"
                     /chromosome="10"
     gene            1..3368
                     /gene="Nfkb1"
                     /note="nuclear factor kappa B subunit 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:124994613"
     CDS             16..2694
                     /gene="Nfkb1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X4"
                     /protein_id="XP_047422690.1"
                     /db_xref="GeneID:124994613"
                     /translation="
MTAICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVNAGPKDMVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGTTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNAESKSDPEDCDTRGGRETINLSGNVIKTTEQDKELGMSSDGNEEVTPTCTMGVKEEDARFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQAAFCTSEASSPVKTTSQAHSLPLLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTNSSSLLTLNKMPQDYGQEGPIEGKI"
     misc_feature    <25..498
                     /gene="Nfkb1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD); Region: RHD-n; cl08275"
                     /db_xref="CDD:447596"
     misc_feature    517..822
                     /gene="Nfkb1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(520..522,526..534,538..546,664..672,709..711,
                     745..747,802..804,811..813,817..819)
                     /gene="Nfkb1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(526..531,535..537,574..576,580..582,586..588,
                     685..690,697..699,703..705)
                     /gene="Nfkb1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(589..591,595..597,688..693)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    <1381..1605
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    order(1393..1395,1399..1401,1411..1416,1423..1431,
                     1435..1440,1450..1452,1459..1461,1504..1506,1510..1512,
                     1516..1518,1528..1533,1540..1548,1552..1557,1567..1569,
                     1576..1578,1603..1605,1609..1611,1615..1617,1627..1632,
                     1639..1647,1651..1656,1666..1668,1675..1677)
                     /gene="Nfkb1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1393..1506
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1510..1605
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1525..1809
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    1717..1809
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1732..>1962
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    1819..1917
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2215..2439
                     /gene="Nfkb1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
tgagaaccctcaacaatgacagctatatgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaacggaaaaaatatccacctgcacgctcacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgaccgacgcatgtgtaaggggctacaatccaggacttttagtgcaccctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcagctcttcagcagacgaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcctgacagcacgggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcacccaatgcatccaacttgaaaatcgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcgtttttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccattgtcttcaaaacgccaaagtataaagatgtcaacattacaaaaccagcctctgtgtttgtccagcttcggaggaaatctgatttggaaactagcgaaccaaaaccttttctctactatcctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggcggtagcggtgccggggctggaggcggaggcatgttcggtagcggcggtggaggagggagcacgggaactacgggtccagggtatggcttcccgcactatggatttcctacgtacggtggaattaccttccaccctggaaccactaaatccaatgctggactgaagcatggaaccatgaatgctgaatctaaaagtgatcctgaagattgtgacacgaggggtggcagagagactataaatctctctgggaacgttatcaaaaccacagaacaagataaggaactgggcatgtccagcgacggaaatgaggaggtgacgccgacgtgcaccatgggagtaaaggaagaggatgctcggtttcaggataacctctttctggagaaggctatgcagcttgccaagaggcacgccaacgcccttttcgactatgcagtgacgggagacgtgaagatgctgctggctgtccagcggcatctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagggatctgctagaagttacatctggtttggtttctgatgatattatcaacatgagaaatgatctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggacttgctgagcgctggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtattttactcaagcacaaaaaggcagcactacttcttgaccatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaatagcctgccatgtctgctgctgctggtggccgctggagcagacgtcaacgcacaggagcagaagtctgggcgaacggcactgcacctggctgtggagcatgacaatatctccttggcgggctgcctgctcctggagggggatgcccacgtggacagtaccacctatgatggaactacacccctacacatcgcagccggcagagggtccaccaagctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaaggctggagaggacgaaggggtcgtgcctggaaccacacccctagatatggctaccagctggcaggtatttgacatcttaaatgggaagccatatgagccagagtttacatctgaggatttgctggcacagggagacatgaaacagctgactgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaacaatgccttccggctgagccctgccccttccaaaactctcatggacaactatgaggtctctggggggacggtcaaagagctggtggaggccctgagacagatgggctacacggaagcaatcgaagttatccaggcggccttctgcacctcagaagcctccagccctgtgaagaccacctctcaggcccactcactgcctctcttgccttcctccacaaggcagcaaatagatgagctgcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccaacagcagctcattgctaactcttaacaaaatgccccaagattacgggcaggaaggacctatagaaggcaaaatttagcctgctggcagtttcccacgctgtgtaaaccaaagtcctagaatcccactgcgttgtccaaaagaaggaaagtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggctgtctaaacatgacttcctttcctggtttttcaatgagttttagttgattcacttgccaatagtatctagcaatcccagcactgcgctgaactgatgtgtcctggggatgaggtagtttattgagctttaccggctgctactggattacagttgctttttgttgtcattgctgctgtccctctgctgcattcccactgtcagggtgtcctcacctggtgttctttctagccgtccatggcacagttgtgcattcagattaaggattaagaaaagagatatttgaatatcagagtcacttagtgtgcaattaaaaaaaaaaggcttattgctttttttaatgtggttatctctgtgatttgaaaaacacatgaacttatcaatatttaaacatggttataatcagtgctgaaaatgatattttcccctttttctgcattttgctattgtaaatatgttttttagatcaaatactttaaaggaaaaatgttggatttataaatgctattttttattttacttttataataaaagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]