2024-05-19 10:06:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047566733 3576 bp mRNA linear ROD 04-MAR-2023 DEFINITION PREDICTED: Sciurus carolinensis nuclear factor kappa B subunit 1 (Nfkb1), transcript variant X4, mRNA. ACCESSION XM_047566733 VERSION XM_047566733.1 DBLINK BioProject: PRJNA823697 KEYWORDS RefSeq. SOURCE Sciurus carolinensis (gray squirrel) ORGANISM Sciurus carolinensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciuromorpha; Sciuridae; Sciurinae; Sciurini; Sciurus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_062222) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_902686445.1-RS_2023_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/03/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3576 /organism="Sciurus carolinensis" /mol_type="mRNA" /db_xref="taxon:30640" /chromosome="10" gene 1..3576 /gene="Nfkb1" /note="nuclear factor kappa B subunit 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 8 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:124994613" CDS 80..2902 /gene="Nfkb1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X3" /protein_id="XP_047422689.1" /db_xref="GeneID:124994613" /translation="
MPLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVNAGPKDMVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGTTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNAESKSDPEDCDTRGGRETINLSGNVIKTTEQDKELGMSSDGNEEVTPTCTMGVKEEDARFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQAAFCTSEASSPVKTTSQAHSLPLLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTNSSSLLTLNKMPQDYGQEGPIEGKI"
misc_feature 101..706 /gene="Nfkb1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(143..145,149..154,158..163,170..181,404..406, 410..415,704..706) /gene="Nfkb1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 725..1030 /gene="Nfkb1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(728..730,734..742,746..754,872..880,917..919, 953..955,1010..1012,1019..1021,1025..1027) /gene="Nfkb1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(734..739,743..745,782..784,788..790,794..796, 893..898,905..907,911..913) /gene="Nfkb1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(797..799,803..805,896..901) /gene="Nfkb1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature <1589..1813 /gene="Nfkb1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature order(1601..1603,1607..1609,1619..1624,1631..1639, 1643..1648,1658..1660,1667..1669,1712..1714,1718..1720, 1724..1726,1736..1741,1748..1756,1760..1765,1775..1777, 1784..1786,1811..1813,1817..1819,1823..1825,1835..1840, 1847..1855,1859..1864,1874..1876,1883..1885) /gene="Nfkb1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1601..1714 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1718..1813 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1733..2017 /gene="Nfkb1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 1925..2017 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1940..>2170 /gene="Nfkb1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 2027..2125 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2423..2647 /gene="Nfkb1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
ttctcattccctttactagatatttcatttgaatcctttgtctcatactatatttaatccagaattatttccaccagagatgccactgcccacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtttgtgaagggccatcccatggcggacttcctggtgcatctagtgagaagaacaagaagtcctaccctcaggtcaaaatatgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaacggaaaaaatatccacctgcacgctcacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgaccgacgcatgtgtaaggggctacaatccaggacttttagtgcaccctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcagctcttcagcagacgaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcctgacagcacgggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcacccaatgcatccaacttgaaaatcgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcgtttttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccattgtcttcaaaacgccaaagtataaagatgtcaacattacaaaaccagcctctgtgtttgtccagcttcggaggaaatctgatttggaaactagcgaaccaaaaccttttctctactatcctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggcggtagcggtgccggggctggaggcggaggcatgttcggtagcggcggtggaggagggagcacgggaactacgggtccagggtatggcttcccgcactatggatttcctacgtacggtggaattaccttccaccctggaaccactaaatccaatgctggactgaagcatggaaccatgaatgctgaatctaaaagtgatcctgaagattgtgacacgaggggtggcagagagactataaatctctctgggaacgttatcaaaaccacagaacaagataaggaactgggcatgtccagcgacggaaatgaggaggtgacgccgacgtgcaccatgggagtaaaggaagaggatgctcggtttcaggataacctctttctggagaaggctatgcagcttgccaagaggcacgccaacgcccttttcgactatgcagtgacgggagacgtgaagatgctgctggctgtccagcggcatctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagggatctgctagaagttacatctggtttggtttctgatgatattatcaacatgagaaatgatctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggacttgctgagcgctggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtattttactcaagcacaaaaaggcagcactacttcttgaccatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaatagcctgccatgtctgctgctgctggtggccgctggagcagacgtcaacgcacaggagcagaagtctgggcgaacggcactgcacctggctgtggagcatgacaatatctccttggcgggctgcctgctcctggagggggatgcccacgtggacagtaccacctatgatggaactacacccctacacatcgcagccggcagagggtccaccaagctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaaggctggagaggacgaaggggtcgtgcctggaaccacacccctagatatggctaccagctggcaggtatttgacatcttaaatgggaagccatatgagccagagtttacatctgaggatttgctggcacagggagacatgaaacagctgactgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaacaatgccttccggctgagccctgccccttccaaaactctcatggacaactatgaggtctctggggggacggtcaaagagctggtggaggccctgagacagatgggctacacggaagcaatcgaagttatccaggcggccttctgcacctcagaagcctccagccctgtgaagaccacctctcaggcccactcactgcctctcttgccttcctccacaaggcagcaaatagatgagctgcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccaacagcagctcattgctaactcttaacaaaatgccccaagattacgggcaggaaggacctatagaaggcaaaatttagcctgctggcagtttcccacgctgtgtaaaccaaagtcctagaatcccactgcgttgtccaaaagaaggaaagtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggctgtctaaacatgacttcctttcctggtttttcaatgagttttagttgattcacttgccaatagtatctagcaatcccagcactgcgctgaactgatgtgtcctggggatgaggtagtttattgagctttaccggctgctactggattacagttgctttttgttgtcattgctgctgtccctctgctgcattcccactgtcagggtgtcctcacctggtgttctttctagccgtccatggcacagttgtgcattcagattaaggattaagaaaagagatatttgaatatcagagtcacttagtgtgcaattaaaaaaaaaaggcttattgctttttttaatgtggttatctctgtgatttgaaaaacacatgaacttatcaatatttaaacatggttataatcagtgctgaaaatgatattttcccctttttctgcattttgctattgtaaatatgttttttagatcaaatactttaaaggaaaaatgttggatttataaatgctattttttattttacttttataataaaagga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]