2024-05-19 05:24:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047482773 640 bp mRNA linear PLN 05-APR-2022 DEFINITION PREDICTED: Impatiens glandulifera autophagy-related protein 8C-like (LOC124942300), mRNA. ACCESSION XM_047482773 VERSION XM_047482773.1 DBLINK BioProject: PRJNA822341 KEYWORDS RefSeq. SOURCE Impatiens glandulifera ORGANISM Impatiens glandulifera Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; asterids; Ericales; Balsaminaceae; Impatiens. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_061867) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Impatiens glandulifera Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..640 /organism="Impatiens glandulifera" /mol_type="mRNA" /db_xref="taxon:253017" /chromosome="6" gene 1..640 /gene="LOC124942300" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 45 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 10 samples with support for all annotated introns" /db_xref="GeneID:124942300" CDS 101..481 /gene="LOC124942300" /codon_start=1 /product="autophagy-related protein 8C-like" /protein_id="XP_047338729.1" /db_xref="GeneID:124942300" /translation="
MAKSSFKSEHPLGRRQAEAGRIREKYPDRIPVIVEKADKSDIPDIDKKKYLVPADLTVGQFVYVVRKRIKLSAEKAIFIFINNVLPSTGSMMSAIYEESKDEDGFLYMTYSGENTFGSSFEEVEDL"
misc_feature 134..442 /gene="LOC124942300" /note="ubiquitin-like (Ubl) domain found in Saccharomyces cerevisiae Atg8p and related proteins; sub-family of the autophagy-related 8 (ATG8) family; Region: Ubl_ATG8; cd16128" /db_xref="CDD:340545" misc_feature order(152..154,161..166,185..187,227..241,245..259, 266..268,275..283,287..292,299..310,317..319,413..415) /gene="LOC124942300" /note="Atg19 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(152..154,164..166,185..187,191..199,239..241, 245..253,257..259,290..292,302..304,413..415) /gene="LOC124942300" /note="peptide binding site 2 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(152..154,185..187,191..193,239..241,245..253, 257..259,281..283,290..292,302..304,413..415) /gene="LOC124942300" /note="peptide binding site 1 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(185..187,212..217,239..241,248..250,275..280, 284..292,296..304,317..322,326..334,338..340,347..355, 359..367,437..442) /gene="LOC124942300" /note="Atg7 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(209..211,284..286,296..298,317..334,338..340, 347..364,425..427,431..442) /gene="LOC124942300" /note="Atg4 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" polyA_site 640 /gene="LOC124942300" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
cctctatatatatgtataaccctaacccttattttcattacttttcttctttaggttcattcatctcatcgctttaagcaataattgtaagtcagacgccatggccaagagttcattcaagtcagaacatccactcggaaggagacaggctgaagctggacgcattagagagaagtacccagatagaattcctgttattgtggagaaagcagataaaagtgatattcctgacattgataagaaaaaatatttggttccagctgacttgactgttggtcagtttgtgtatgttgtgcgtaagaggattaagctaagtgcagagaaggctatattcatctttattaacaatgttttgccatccactggttctatgatgtctgcaatctatgaggaaagcaaggatgaagatgggtttctttacatgacttacagtggtgaaaacacgtttggatcatcattcgaagaagtggaagatctgtgaataaagcaacagcagacatctatgaatgtgtagatattagggcaatctgcaatctgtctttcatttgaactactattatgtttttgaattttaactaagaacacgatgattttatttttttatgcagtaaatataacaaataatgagctgatttcatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]