2024-05-19 04:49:53, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047476829 498 bp mRNA linear PLN 05-APR-2022 DEFINITION PREDICTED: Impatiens glandulifera autophagy-related protein 8C-like (LOC124936337), mRNA. ACCESSION XM_047476829 VERSION XM_047476829.1 DBLINK BioProject: PRJNA822341 KEYWORDS RefSeq. SOURCE Impatiens glandulifera ORGANISM Impatiens glandulifera Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; asterids; Ericales; Balsaminaceae; Impatiens. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_061865) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Impatiens glandulifera Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..498 /organism="Impatiens glandulifera" /mol_type="mRNA" /db_xref="taxon:253017" /chromosome="4" gene 1..498 /gene="LOC124936337" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 63 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 17 samples with support for all annotated introns" /db_xref="GeneID:124936337" CDS 92..451 /gene="LOC124936337" /codon_start=1 /product="autophagy-related protein 8C-like" /protein_id="XP_047332785.1" /db_xref="GeneID:124936337" /translation="
MANSSFKSEHPLGKRQAEAARIREKYPDRIPVIVEKADRSDIPDIDKKKYLVPSDLTVGQFVYVVRKRIKLSSEKAIFIFVKNTLPSTAAMMYTVYEENKDEDGFLYMTYSGENTFGSY"
misc_feature 125..433 /gene="LOC124936337" /note="ubiquitin-like (Ubl) domain found in Saccharomyces cerevisiae Atg8p and related proteins; sub-family of the autophagy-related 8 (ATG8) family; Region: Ubl_ATG8; cd16128" /db_xref="CDD:340545" misc_feature order(143..145,152..157,176..178,218..232,236..250, 257..259,266..274,278..283,290..301,308..310,404..406) /gene="LOC124936337" /note="Atg19 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(143..145,155..157,176..178,182..190,230..232, 236..244,248..250,281..283,293..295,404..406) /gene="LOC124936337" /note="peptide binding site 2 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(143..145,176..178,182..184,230..232,236..244, 248..250,272..274,281..283,293..295,404..406) /gene="LOC124936337" /note="peptide binding site 1 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(176..178,203..208,230..232,239..241,266..271, 275..283,287..295,308..313,317..325,329..331,338..346, 350..358,428..433) /gene="LOC124936337" /note="Atg7 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(200..202,275..277,287..289,308..325,329..331, 338..355,416..418,422..433) /gene="LOC124936337" /note="Atg4 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" polyA_site 498 /gene="LOC124936337" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
cttgcccaccactctctccatctctcttagctgtttccctgttcataaaattattaaaaccctaaccctaatcctttctatcaggattatcatggcgaatagttccttcaagtcagaacatccactcggaaagagacaggctgaagctgcacgaatcagggagaaatacccagatagaattcctgttattgtggagaaagcagacagaagtgatattcctgacattgataagaagaaatatcttgttccttctgatttgactgttggtcagtttgtgtatgttgttcgtaagaggattaagctaagttctgagaaggctatatttatctttgttaagaacactttgccctccacagctgctatgatgtatacagtttatgaagaaaacaaagatgaagatgggtttctttacatgacttacagtggcgaaaacacgtttggatcatactgaaaagggatgtggataatggagagattgaagatgtgtgaataataaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]