GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 05:24:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_043739540            4284 bp    mRNA    linear   INV 21-SEP-2021
DEFINITION  PREDICTED: Bombus pyrosoma copper-transporting ATPase 1
            (LOC122573337), transcript variant X11, mRNA.
ACCESSION   XM_043739540
VERSION     XM_043739540.1
DBLINK      BioProject: PRJNA759419
KEYWORDS    RefSeq.
SOURCE      Bombus pyrosoma
  ORGANISM  Bombus pyrosoma
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Bombus; Melanobombus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_057781.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bombus pyrosoma Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4284
                     /organism="Bombus pyrosoma"
                     /mol_type="mRNA"
                     /isolate="SC7728"
                     /isolation_source="wild"
                     /db_xref="taxon:396416"
                     /tissue_type="whole body"
                     /country="China: Hebei"
                     /collection_date="Aug-2016"
                     /linkage_group="LG12"
     gene            1..4284
                     /gene="LOC122573337"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 8 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:122573337"
     CDS             464..4177
                     /gene="LOC122573337"
                     /codon_start=1
                     /product="copper-transporting ATPase 1 isoform X4"
                     /protein_id="XP_043595475.1"
                     /db_xref="GeneID:122573337"
                     /translation="
MVCVSRPQKMKDSTNASTMKVNIEGMRCQSCVKNIEGTIGGRPEVLSVKVILEEKLGYIEYKAGEITPNELVEAIEDMGFTASLCSDETNSTEKIQKSDSLQLTIGTCTVHIDGMTCASCVKTITDGLSEKAGIKQANVSLEKKEATVSYNDKVLTAEQISGFVEEMGFNSFVKEVNGKVVGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNEIAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDISSSISELGFPTTLIEELGTGEGDIELKITGMTCASCVNKIESTVRKLPGVHSAAVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFINKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSVGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLTAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLLVWIIVGYVNVNSLPISHNDQINKHGMNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSEATGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYTNEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTSPDDVYEICVGNREWMRRNAINIPQEVELKMVTEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETPEYLSAMHAHSTARMIDLDTISLHRGLDDTVIPIMHRSTSTLSRLFRRSKDDVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"
     misc_feature    521..712
                     /gene="LOC122573337"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(539..547,554..556)
                     /gene="LOC122573337"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    797..970
                     /gene="LOC122573337"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(806..814,821..823)
                     /gene="LOC122573337"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1124..1318
                     /gene="LOC122573337"
                     /note="copper chaperone CopZ; Region: chaper_CopZ_Eh;
                     NF033794"
                     /db_xref="CDD:411374"
     misc_feature    1349..1537
                     /gene="LOC122573337"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1367..1375,1382..1384)
                     /gene="LOC122573337"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1616..3877
                     /gene="LOC122573337"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2609..2611,2615..2617,3746..3748)
                     /gene="LOC122573337"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2741..2749,2951..2953,3197..3205,3293..3295,
                     3413..3421,3479..3481,3488..3490,3497..3499,3554..3556,
                     3563..3565)
                     /gene="LOC122573337"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     misc_feature    2741..2761
                     /gene="LOC122573337"
                     /note="P-type ATPase signature motif; other site"
                     /db_xref="CDD:319783"
     misc_feature    2741..2743
                     /gene="LOC122573337"
                     /note="phosphorylation site [posttranslational
                     modification]"
                     /db_xref="CDD:319783"
     misc_feature    order(3749..3751,3830..3832,3842..3844)
                     /gene="LOC122573337"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     polyA_site      4284
                     /gene="LOC122573337"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cagtcgtatcgcgagagatgctgactcgagcgcattattttcctgtacaattttcacattaaccgacaaacgtgcaagttacataaaacagaaagtatttcctcttaagataagagagagtaacgtagcttatttacgtttcgggtcactgtaaacgataatatcgcgtttttaataagactaattttgctaattgctcgttaaaaattcgaatcgatgacgagaagatggtgctgctcatcgttttgatcattgacgttcaatttggaggaaaatcactgtaattggaaagaaatatgttcgctcgatcgtattctaacgtttaaacgaataactcgcttcgaagatcgaccgatgacaattactttcttttatcgtttataaaacgaacgatagccaagctgcttcggttgcataatgcagcgatggggaggacgataccgattacgaaggcacgacaccgatggtgtgcgtttctcggccgcagaaaatgaaagattccacgaatgcttccactatgaaggttaatatcgagggtatgagatgtcagagctgtgtgaagaacatcgagggaaccataggtggccggccggaggttttaagcgttaaagtaatcctagaggagaagctcggttacatcgaatataaagcgggagaaattacgccgaacgaattggtcgaggcgatagaggatatgggattcaccgcttccctttgcagcgacgaaactaactctactgaaaagatacaaaaaagtgattcgttgcaattaactatcggtacttgtactgtacatatcgatggaatgacttgtgcgtcttgcgttaaaactatcaccgatggtttatcggagaaagcaggaataaagcaggcgaacgttagtttagagaagaaggaagctacggtttcttataacgataaagtcctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttgtaggagaggaaacaccaatgaatttatcgttaaaaaacaattctgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcaaaacgaaatagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgttgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtcgcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgatcgacatttcttctagcatatcggaattgggcttccctactactttgatcgaggaacttggcactggagagggagacattgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattgccaggcgtccattctgccgctgtcgcgttggcaactcaacgtggcaaattcaaatacgatgtggaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttatcaataaagataaagaaaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgttcttagtgtccttaatttttggcataccgtgtatgttagccatgacgtactttatggtaatcatgtctgttggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaacttaatccttttcatattttctacaccagtccagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgacgactacgatatcttatttgtactcagttgccgtacttacagcagccatgataatgcaggaacacgttagtcctcagacattttttgacactcctccgatgttgttagtgttcatcagtttaggaagatggttagaacacgtcgcaaagggtaaaacctcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaataatgaactactatctgagcgtttaatcagtatagatttagtacaacgaggcgatgtcctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtgccaaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaattactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagccgataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttactcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgaccaaatcaataaacacggaatgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcaatagcttgtccatgcgctttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaaatgtattgtattcgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttggtcattatctgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcgatacgtgaaggaaacgataggctccgaagcaactggacagtgcatgaattttcaagcagttgctggttgcggacttaaatgtaaagtatcacacatttcaactacgttggccgatgcattaaaatctgataagattcttaactatactaacgaggtaaaaagattaccttctggaacgcataatttaaataatgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactagtcctgacgatgtatatgaaatttgcgttggtaacagggagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttaccgaagaagatctgggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagtgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaaaatgggtttggaagtcattcttttaacaggagataatagaaagactgctgtttctattgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcctaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagacgttggcattgcaatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaacgatcttctagatgttattgcgtgtctggatctatcgagaaaaacagttcgtcgaataagattgaattttttatttgccagtatctataatttgttgggtattcctattgctgctggaatatttagctctttcgggttttttcttcaaccttggatgtcgtcagcggcgatggcattaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccaacgaagaccactttagaaacaccagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatctagatacaatatctcttcatcgtggtttagatgatactgtaatacctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacgatgtagagggtcgcctcctaggtgaagatattgatgaaattgatttggtaacagatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatgacttgtaaggatcttctttatataattcttattctgtgcatgtgtgtgtgtgtgcgcgcgcacggacatttttttgccaataatataataaactgacatttaatcaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]