LOCUS       XM_043739538            4624 bp    mRNA    linear   INV 21-SEP-2021
DEFINITION  PREDICTED: Bombus pyrosoma copper-transporting ATPase 1
            (LOC122573337), transcript variant X6, mRNA.
ACCESSION   XM_043739538
VERSION     XM_043739538.1
DBLINK      BioProject: PRJNA759419
KEYWORDS    RefSeq.
SOURCE      Bombus pyrosoma
  ORGANISM  Bombus pyrosoma
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Bombus; Melanobombus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_057781.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bombus pyrosoma Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4624
                     /organism="Bombus pyrosoma"
                     /mol_type="mRNA"
                     /isolate="SC7728"
                     /isolation_source="wild"
                     /db_xref="taxon:396416"
                     /tissue_type="whole body"
                     /country="China: Hebei"
                     /collection_date="Aug-2016"
                     /linkage_group="LG12"
     gene            1..4624
                     /gene="LOC122573337"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 8 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:122573337"
     CDS             705..4517
                     /gene="LOC122573337"
                     /codon_start=1
                     /product="copper-transporting ATPase 1 isoform X2"
                     /protein_id="XP_043595473.1"
                     /db_xref="GeneID:122573337"
                     /translation="

MRKIAKTWRYKLLNSTKYLGDGEDDTDYEGTTPMVCVSRPQKMKDSTNASTMKVNIEGMRCQSCVKNIEGTIGGRPEVLSVKVILEEKLGYIEYKAGEITPNELVEAIEDMGFTASLCSDETNSTEKIQKSDSLQLTIGTCTVHIDGMTCASCVKTITDGLSEKAGIKQANVSLEKKEATVSYNDKVLTAEQISGFVEEMGFNSFVKEVNGKVVGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNEIAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDISSSISELGFPTTLIEELGTGEGDIELKITGMTCASCVNKIESTVRKLPGVHSAAVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFINKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSVGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLTAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLLVWIIVGYVNVNSLPISHNDQINKHGMNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSEATGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYTNEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTSPDDVYEICVGNREWMRRNAINIPQEVELKMVTEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETPEYLSAMHAHSTARMIDLDTISLHRGLDDTVIPIMHRSTSTLSRLFRRSKDDVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"

     misc_feature    861..1052
                     /gene="LOC122573337"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(879..887,894..896)
                     /gene="LOC122573337"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1137..1310
                     /gene="LOC122573337"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1146..1154,1161..1163)
                     /gene="LOC122573337"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1464..1658
                     /gene="LOC122573337"
                     /note="copper chaperone CopZ; Region: chaper_CopZ_Eh;
                     NF033794"
                     /db_xref="CDD:411374"
     misc_feature    1689..1877
                     /gene="LOC122573337"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1707..1715,1722..1724)
                     /gene="LOC122573337"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1956..4217
                     /gene="LOC122573337"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2949..2951,2955..2957,4086..4088)
                     /gene="LOC122573337"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3081..3089,3291..3293,3537..3545,3633..3635,
                     3753..3761,3819..3821,3828..3830,3837..3839,3894..3896,
                     3903..3905)
                     /gene="LOC122573337"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     misc_feature    3081..3101
                     /gene="LOC122573337"
                     /note="P-type ATPase signature motif; other site"
                     /db_xref="CDD:319783"
     misc_feature    3081..3083
                     /gene="LOC122573337"
                     /note="phosphorylation site [posttranslational
                     modification]"
                     /db_xref="CDD:319783"
     misc_feature    order(4089..4091,4170..4172,4182..4184)
                     /gene="LOC122573337"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     polyA_site      4624
                     /gene="LOC122573337"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

aaaatataacatatttttatattaaagattacaaaatattgtattattttacgattaattttgtatttaattttatacatacgtttgcgtatcttttataatgctaatcaaacaggttaaatggcagagaagaatagaacaaaaatggttgctttgtacagagtaaatatgtggcatggataattattgttgatagtattatcgcttaactttaattatttaaatattgccaattgtccaaggacaaattattttttcgttccgttaaattcgtattggtaattggtaagaggaaacgcgtatataaaggaaacgtaactttgttaaaaaagtaatacatataagttgatcgtatcgaagacgtaaaataacgcgcgatagttttgaaaattaaacgacaatgctttgatgacgaaacgcgaagaacagaagaatgttattgagcgctcatatttcaaaaagcacttggtgactcgcagtagttttattttctaatcgacacagggggatagatcgattcgaaatttgatcgtgatctatcgatcgttcaaacctataagtgtgtaacaaacgtatttccttcgcttcgcctatcgaataactccaattttatcgcgagtcaattcgtaaaacattatgctatcgtgacgttctttacattttaacgattactctttcgatttattttatgcaatcgtatcgtaatgcggaagatcgcaaaaacgtggcggtacaaattactgaattctacaaaatacttgggcgatggggaggacgataccgattacgaaggcacgacaccgatggtgtgcgtttctcggccgcagaaaatgaaagattccacgaatgcttccactatgaaggttaatatcgagggtatgagatgtcagagctgtgtgaagaacatcgagggaaccataggtggccggccggaggttttaagcgttaaagtaatcctagaggagaagctcggttacatcgaatataaagcgggagaaattacgccgaacgaattggtcgaggcgatagaggatatgggattcaccgcttccctttgcagcgacgaaactaactctactgaaaagatacaaaaaagtgattcgttgcaattaactatcggtacttgtactgtacatatcgatggaatgacttgtgcgtcttgcgttaaaactatcaccgatggtttatcggagaaagcaggaataaagcaggcgaacgttagtttagagaagaaggaagctacggtttcttataacgataaagtcctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttgtaggagaggaaacaccaatgaatttatcgttaaaaaacaattctgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcaaaacgaaatagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgttgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtcgcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgatcgacatttcttctagcatatcggaattgggcttccctactactttgatcgaggaacttggcactggagagggagacattgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattgccaggcgtccattctgccgctgtcgcgttggcaactcaacgtggcaaattcaaatacgatgtggaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttatcaataaagataaagaaaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgttcttagtgtccttaatttttggcataccgtgtatgttagccatgacgtactttatggtaatcatgtctgttggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaacttaatccttttcatattttctacaccagtccagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgacgactacgatatcttatttgtactcagttgccgtacttacagcagccatgataatgcaggaacacgttagtcctcagacattttttgacactcctccgatgttgttagtgttcatcagtttaggaagatggttagaacacgtcgcaaagggtaaaacctcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaataatgaactactatctgagcgtttaatcagtatagatttagtacaacgaggcgatgtcctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtgccaaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaattactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagccgataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttactcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgaccaaatcaataaacacggaatgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcaatagcttgtccatgcgctttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaaatgtattgtattcgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttggtcattatctgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcgatacgtgaaggaaacgataggctccgaagcaactggacagtgcatgaattttcaagcagttgctggttgcggacttaaatgtaaagtatcacacatttcaactacgttggccgatgcattaaaatctgataagattcttaactatactaacgaggtaaaaagattaccttctggaacgcataatttaaataatgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactagtcctgacgatgtatatgaaatttgcgttggtaacagggagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttaccgaagaagatctgggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagtgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaaaatgggtttggaagtcattcttttaacaggagataatagaaagactgctgtttctattgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcctaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagacgttggcattgcaatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaacgatcttctagatgttattgcgtgtctggatctatcgagaaaaacagttcgtcgaataagattgaattttttatttgccagtatctataatttgttgggtattcctattgctgctggaatatttagctctttcgggttttttcttcaaccttggatgtcgtcagcggcgatggcattaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccaacgaagaccactttagaaacaccagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatctagatacaatatctcttcatcgtggtttagatgatactgtaatacctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacgatgtagagggtcgcctcctaggtgaagatattgatgaaattgatttggtaacagatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatgacttgtaaggatcttctttatataattcttattctgtgcatgtgtgtgtgtgtgcgcgcgcacggacatttttttgccaataatataataaactgacatttaatcaaa

//