LOCUS       XM_042237661             889 bp    mRNA    linear   MAM 30-OCT-2023
DEFINITION  PREDICTED: Ovis aries copper chaperone for superoxide dismutase
            (CCS), transcript variant X3, mRNA.
ACCESSION   XM_042237661
VERSION     XM_042237661.1
DBLINK      BioProject: PRJNA739192
KEYWORDS    RefSeq.
SOURCE      Ovis aries (sheep)
  ORGANISM  Ovis aries
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
            Pecora; Bovidae; Caprinae; Ovis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_056074.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_016772045.2-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/17/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..889
                     /organism="Ovis aries"
                     /mol_type="mRNA"
                     /strain="OAR_USU_Benz2616"
                     /db_xref="taxon:9940"
                     /chromosome="21"
                     /sex="female"
                     /tissue_type="Blood, lung, liver"
                     /dev_stage="adult"
                     /collection_date="2015-03-01"
                     /breed="Rambouillet"
     gene            1..889
                     /gene="CCS"
                     /note="copper chaperone for superoxide dismutase; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 EST, 14 long SRA reads, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     96 samples with support for all annotated introns"
                     /db_xref="GeneID:100846985"
     misc_feature    1
                     /gene="CCS"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             67..777
                     /gene="CCS"
                     /codon_start=1
                     /product="copper chaperone for superoxide dismutase
                     isoform X3"
                     /protein_id="XP_042093595.1"
                     /db_xref="GeneID:100846985"
                     /translation="

MASDSENRGTACTLEFAVQMTCQSCVDAVRTSLQGIAGIQSVEVQLENQMVLVQTTLPSQEVQALLEGTGRQAVLKGMGSGLSQNLGAAVAILGGPGPVQGVVRFLQLTPEHCLIEGTIDGLQPGLHGLHVHQFGDLTRNCNSCGDHFNPDGMSHGGPQDSQRPGEGDTQNSVVAAQPEHLCRSLREALGTQSKLQIQSEGHRQWERASQRSTAETWGMSVPMRVAELSSGLRMSS"

     misc_feature    106..>516
                     /gene="CCS"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      

gttcgctgcggcgcggctctgggctggcgcttcagttcgggccctggggctatagctggatccaggatggcttcggactcggagaaccgtgggactgcctgcacgctggagttcgcggtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaagggatcgcaggcatccaaagtgtggaggtgcagttggagaaccagatggtcctggtgcagactaccctgcccagccaggaggtacaggcccttctagaaggcactgggaggcaggcggtcctaaagggcatgggcagtggcctgtcgcagaatttaggggcagccgtggccattctcggggggcctggccctgtgcagggagtggtgcgcttcctgcagctgacccctgagcactgcctaatcgaggggaccattgatggcctgcagcctgggctgcatggactccacgtccatcagttcggggacctcacgaggaactgcaacagctgtggggaccactttaaccctgatggaatgtcccatgggggcccccaggactctcaacggcctggtgagggagacactcagaactccgtggttgcagcacagccagaacatctttgcaggagcctccgggaggccctgggaacccagagcaagctccagatccagtccgaagggcacaggcagtgggagagagcttcccagagaagcaccgcggagacctggggaatgtccgtgccgatgagagtggccgagctatcttcaggattgaggatgagcagctgaaggtgtgggatgtgattggccgaagcctggtcgttgatgagggagaagatgacctgggccggggcgggcatccgttgtccaagatcacagggaactcgggagagaggtgagc

//