2024-05-19 08:22:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_042237661 889 bp mRNA linear MAM 30-OCT-2023 DEFINITION PREDICTED: Ovis aries copper chaperone for superoxide dismutase (CCS), transcript variant X3, mRNA. ACCESSION XM_042237661 VERSION XM_042237661.1 DBLINK BioProject: PRJNA739192 KEYWORDS RefSeq. SOURCE Ovis aries (sheep) ORGANISM Ovis aries Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia; Pecora; Bovidae; Caprinae; Ovis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_056074.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_016772045.2-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/17/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..889 /organism="Ovis aries" /mol_type="mRNA" /strain="OAR_USU_Benz2616" /db_xref="taxon:9940" /chromosome="21" /sex="female" /tissue_type="Blood, lung, liver" /dev_stage="adult" /collection_date="2015-03-01" /breed="Rambouillet" gene 1..889 /gene="CCS" /note="copper chaperone for superoxide dismutase; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, 14 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 96 samples with support for all annotated introns" /db_xref="GeneID:100846985" misc_feature 1 /gene="CCS" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 67..777 /gene="CCS" /codon_start=1 /product="copper chaperone for superoxide dismutase isoform X3" /protein_id="XP_042093595.1" /db_xref="GeneID:100846985" /translation="
MASDSENRGTACTLEFAVQMTCQSCVDAVRTSLQGIAGIQSVEVQLENQMVLVQTTLPSQEVQALLEGTGRQAVLKGMGSGLSQNLGAAVAILGGPGPVQGVVRFLQLTPEHCLIEGTIDGLQPGLHGLHVHQFGDLTRNCNSCGDHFNPDGMSHGGPQDSQRPGEGDTQNSVVAAQPEHLCRSLREALGTQSKLQIQSEGHRQWERASQRSTAETWGMSVPMRVAELSSGLRMSS"
misc_feature 106..>516 /gene="CCS" /note="copper, zinc superoxide dismutase; Region: PLN02957" /db_xref="CDD:215516" ORIGIN
gttcgctgcggcgcggctctgggctggcgcttcagttcgggccctggggctatagctggatccaggatggcttcggactcggagaaccgtgggactgcctgcacgctggagttcgcggtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaagggatcgcaggcatccaaagtgtggaggtgcagttggagaaccagatggtcctggtgcagactaccctgcccagccaggaggtacaggcccttctagaaggcactgggaggcaggcggtcctaaagggcatgggcagtggcctgtcgcagaatttaggggcagccgtggccattctcggggggcctggccctgtgcagggagtggtgcgcttcctgcagctgacccctgagcactgcctaatcgaggggaccattgatggcctgcagcctgggctgcatggactccacgtccatcagttcggggacctcacgaggaactgcaacagctgtggggaccactttaaccctgatggaatgtcccatgggggcccccaggactctcaacggcctggtgagggagacactcagaactccgtggttgcagcacagccagaacatctttgcaggagcctccgggaggccctgggaacccagagcaagctccagatccagtccgaagggcacaggcagtgggagagagcttcccagagaagcaccgcggagacctggggaatgtccgtgccgatgagagtggccgagctatcttcaggattgaggatgagcagctgaaggtgtgggatgtgattggccgaagcctggtcgttgatgagggagaagatgacctgggccggggcgggcatccgttgtccaagatcacagggaactcgggagagaggtgagc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]