GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 10:06:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_038423391            1062 bp    mRNA    linear   MAM 07-JAN-2021
DEFINITION  PREDICTED: Canis lupus familiaris copper chaperone for superoxide
            dismutase (CCS), transcript variant X2, mRNA.
ACCESSION   XM_038423391
VERSION     XM_038423391.1
DBLINK      BioProject: PRJNA681562
KEYWORDS    RefSeq.
SOURCE      Canis lupus familiaris (dog)
  ORGANISM  Canis lupus familiaris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
            Canis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051822.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Canis lupus familiaris Annotation
                                           Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1062
                     /organism="Canis lupus familiaris"
                     /mol_type="mRNA"
                     /isolate="SID07034"
                     /sub_species="familiaris"
                     /db_xref="taxon:9615"
                     /chromosome="18"
                     /sex="male"
                     /tissue_type="fibroblast, soft palate"
                     /dev_stage="adult"
                     /breed="Labrador retriever"
     gene            1..1062
                     /gene="CCS"
                     /note="copper chaperone for superoxide dismutase; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 mRNA, 38 ESTs, 2 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     25 samples with support for all annotated introns"
                     /db_xref="GeneID:442988"
                     /db_xref="VGNC:VGNC:38919"
     CDS             133..900
                     /gene="CCS"
                     /codon_start=1
                     /product="copper chaperone for superoxide dismutase
                     isoform X1"
                     /protein_id="XP_038279319.1"
                     /db_xref="GeneID:442988"
                     /db_xref="VGNC:VGNC:38919"
                     /translation="
MTCQSCVDAVRTSLQGVAGIQSVKVQLENQMVLVQTTLPSQEVQALLESTGRQAVLKGMGSGLLQNLGAAVAILEGPGPVQGVVRFLQLTPERCLIEGTIDGLEPGLHGLHVHQFGDLTGNCNSCGDHFNPDGASHGGPKDSDRHRGDLGNVHAGTDGRAIFRIEDEQLKVWDVIGRSLVIDEGEDDLGLGGHPLSKVTGNSGERLACGIIARSAGLFQNPKQICSCDGLTIWEERGRPIAGEGRKEPAKPPAHL"
     misc_feature    133..834
                     /gene="CCS"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      
cagccgtgagactggcaacggcaacagcatcggggcctccggcgggaggggcttctgagattctgggcacgtcgccttgcgggggaagagcgacagcggacacagcaaccggtgctggagttcacagtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaaggggtggcaggcatccagagtgttaaagtgcagttggaaaaccagatggtcctggtgcagaccaccctgcccagccaagaggtgcaggcccttctggaaagcacagggcggcaggcagtactcaagggcatgggcagtggcctcctgcagaatctgggagcagcagttgccattctggagggccctggtcccgtgcaaggggtggtgcgcttcctacagctgacccctgaacgctgcctcatcgaggggactatcgatggcctggagcctgggctgcatggactccatgtccatcagtttggagacctcaccgggaactgcaacagctgcggggaccactttaaccctgatggagcatctcacgggggccctaaggactctgaccggcaccgtggggacctggggaatgtccatgctggcactgatggccgagccatcttcaggatagaggatgagcagctgaaggtatgggatgtgattggccgaagcctggtcatcgatgaaggagaagatgatctgggcctgggtggccatcccttatccaaggtcacaggaaactcaggagagaggttggcctgtggcatcatcgcacgctctgctggccttttccagaaccctaagcagatctgctcctgtgatggccttaccatctgggaggagcgaggccggcccattgctggtgagggacgaaaggagccagccaagccccctgcccacctctgaacatggcctcagcttcgggtttgttctcccagctgtgcactgtctacttccagagagaggggagggaggccctgcttgcccagtcctaggaggacttgggtacagggtgtgaaggttgctgtgatgttcccttgcaaattaaagttttattttcctacagaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]