2024-05-19 12:30:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_037215152 2406 bp mRNA linear INV 06-NOV-2020 DEFINITION PREDICTED: Pollicipes pollicipes copper-transporting ATPase 2-like (LOC119092175), mRNA. ACCESSION XM_037215152 VERSION XM_037215152.1 DBLINK BioProject: PRJNA624368 KEYWORDS RefSeq; includes ab initio. SOURCE Pollicipes pollicipes ORGANISM Pollicipes pollicipes Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea; Multicrustacea; Cirripedia; Thoracica; Thoracicalcarea; Pollicipedomorpha; Pollicipedidae; Pollicipes. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023596297.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Pollicipes pollicipes Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 26% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..2406 /organism="Pollicipes pollicipes" /mol_type="mRNA" /isolate="AB1234" /isolation_source="Intertidal rocks in small coastal promontory heavily exposed to wave action" /db_xref="taxon:41117" /chromosome="Unknown" /tissue_type="whole adults" /dev_stage="adult" /country="Spain: Pontevedra, Nigran, Cape Monteferro" /lat_lon="42.155917 N 8.849778 W" /collection_date="04-Jan-2018" /collected_by="Marcos Perez-Losada" gene 1..2406 /gene="LOC119092175" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 77% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:119092175" CDS 385..2406 /gene="LOC119092175" /codon_start=1 /product="copper-transporting ATPase 2-like" /protein_id="XP_037071047.1" /db_xref="GeneID:119092175" /translation="
MTPSGRGGAGTMMTQLVDLEPPEMTATISIKGMTCQSCVRNIETTVGDNAGIHSIVVSLPDESATVTFDPQLTSPQGICDMIDDMGFDASLPAAAGGGGDGAGDGASRTVVLDIGGMTCQSCVRNIEATVGGRPGVRAVRVDLAAARGWLEVAPELADQQLIDWVEEMGFEARLAAELQCRLAIENMSCQSCVRNIEGKVAAQPGVLGVKVDLEAKEGVITYNPQVTSPGTLEDFVNGIGKFRAAVKPPSDGSSTGPAQDKPDGRSDSPPRQALLSARTPGESPRSPPKPPRSPQSATRSPEKTPVSPGKSTRSAADELETCTVSIRGMTCASCVSAIEKHMNKVDGVESILVALLAGKAEVQYDPAVLLPSQVAGLISDIGFPAQLLENHSPEGTLDLEIRGMTCASCVHTIETNVVRRPGVVSVSVALATERGRVVFDPGQTGPRDIIQAIEDLGFEAALRSGKQGSASYLDHREEIAKWRNSFLVSLFFGVPCMLIMFIGGRHFYVAAVKSLRHGAASMDVLIMLATTVSYVYSVAVVVAAMLLQESGKTSEALAKLISLQPTEAVLVTLGENREVLTEDSISVELVHRGDILKVVPGAKVPVDGRVLSGHSLCDESLITGESMPVAKKPAESKIKPSRLAAADTDAARFSNSSQRLPEHDRHQASTTHG"
misc_feature 463..654 /gene="LOC119092175" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(481..489,496..498) /gene="LOC119092175" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 715..903 /gene="LOC119092175" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(733..741,748..750) /gene="LOC119092175" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 928..1107 /gene="LOC119092175" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(943..951,958..960) /gene="LOC119092175" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1351..1539 /gene="LOC119092175" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1369..1377,1384..1386) /gene="LOC119092175" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1570..>2283 /gene="LOC119092175" /note="Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217" /db_xref="CDD:225127" ORIGIN
cgtcggaggcggtggtaacctccaaggctagtaatctcgtcagcctggtaggggaacaagctcgttttgtctcttcggtgtttaggcacacagcagcggacgcctgaagcctctgggaggcattacgaagtgtaccggcgtcgcgccgggcagcagccgccggccgcggcgcgtgagtgacgtcatagcgaactccggcctgccggtgcggcgggcggcatccggccggccggctgtcaagtgccgggcaggctccgtgcctggtgggtggcgaccgtggggcggctacctggccgtgcgcggtcgcggcggccccggacggagacggccgtcacggacgacggagtgacgtgacgcgcgtgtgacgtcaacgggacggccaggatgacgccgtcgggcagaggcggagcgggcacgatgatgacccagctcgtggacttggaaccgcccgagatgactgccaccatcagcatcaaaggcatgacctgccagtcttgcgtgcgcaacatcgagacgacggtcggcgacaacgccggcatccactccatcgtcgtctcgctgccggacgagagcgccaccgtgaccttcgacccgcagctgacctcaccgcaaggcatctgtgacatgatcgacgacatgggcttcgacgcgtcgctgccggcggcggccggcggcggcggcgacggcgcgggcgacggagcctcgcgcacagtcgtgctcgacatcggcggcatgacgtgccagtcgtgtgtgcgcaacatcgaggcgacggtcggcggccggccgggcgtgcgcgccgtgcgcgttgacctggcggcggcgcgcggctggctggaggtggcgcccgagctcgccgaccagcagctgatcgactgggtggaggagatgggcttcgaggcgcgcctggccgccgagctgcagtgccgcctggccatcgagaacatgagctgccagtcgtgcgtgcggaacatcgagggcaaggtggccgcccagccgggggtgctcggcgtcaaggtggacctggaggccaaggagggcgtcatcacctacaacccgcaggtcacttctcccggcacgctggaggacttcgtcaacggcatcgggaagtttagggccgccgtgaagccaccgtcggatggatcttccacaggacccgcgcaggacaagccggacggccggtcggactcgccgccgcggcaggcgctgctctcggcccgcacgccgggcgagtcgccgcgctcgccgccgaagccgccgcgctcgccgcagagcgccacccgtagcccggagaagacgcccgtcagtccagggaagtcaacacgctcggcggccgacgagctggagacgtgcaccgtctccatccgcggcatgacgtgcgccagctgcgtcagcgccatcgagaagcacatgaacaaggtggacggtgtggaatcgatcctggtggcgctgctggctggcaaagccgaggtgcagtacgacccggccgtgctgctgccctcgcaggtggccggcctgatctccgacattggcttcccggcccagctgctggagaaccacagcccggagggcacgctcgacctcgagatccgcgggatgacctgcgcctcgtgcgtgcacacgatcgagacgaacgtggtgcggcggccgggcgtggtgtccgtgtcggtggcgctggcgacggagcgcgggcgggtcgtgttcgacccgggccagacgggaccgcgagacatcatccaggcgatcgaggacctgggcttcgaggcggcgctccgctcgggcaagcagggcagcgcgtcgtacctggaccaccgcgaggagatcgccaagtggcgcaactcgttcctggtgtcgctgttcttcggcgtgccgtgcatgctcatcatgtttatcggcggccggcacttctacgtggcggcggtgaagtcgctgcgccacggcgccgcctccatggacgtgctcatcatgctggccacgaccgtgtcgtacgtgtactcggtggccgtggtggtggcggccatgctgctgcaggagtcgggcaagacgtctgaggcgctggccaagctgatctcgctgcagcccactgaggcggtgctggtgacgctgggggagaacagggaggtgctcacagaggacagcatctccgtcgagctggtgcaccgcggcgacatcctcaaggtggtgcccggcgccaaggtgccggtggacggccgtgtcctcagtggccactccctgtgcgacgagtccctcatcaccggcgagtccatgcccgtcgccaagaagccagccgagtccaaaatcaagccatcgcggcttgcggcagcggacaccgacgccgcacgattcagcaacagctcacaacggctccccgaacatgaccggcaccaggccagcacaactcacggatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]