LOCUS       XM_037037954            2034 bp    mRNA    linear   MAM 14-JUN-2021
DEFINITION  PREDICTED: Sturnira hondurensis copper-transporting ATPase 1-like
            (LOC118981214), partial mRNA.
ACCESSION   XM_037037954
VERSION     XM_037037954.1
DBLINK      BioProject: PRJNA673222
KEYWORDS    RefSeq; corrected model; includes ab initio.
SOURCE      Sturnira hondurensis
  ORGANISM  Sturnira hondurensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Phyllostomidae; Stenodermatinae; Sturnira.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023507979.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Sturnira hondurensis Updated
                                           Annotation Release 100.20210611
            Annotation Version          :: 100.20210611
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio   :: 2% of CDS bases
            frameshifts :: corrected 1 indel
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-57                VSFL01002032.1     33557-33613         c
            58-198              VSFL01002032.1     31165-31305         c
            199-688             VSFL01002032.1     21467-21956         c
            689-1417            VSFL01002032.1     20015-20743         c
            1418-1624           VSFL01002032.1     10227-10433         c
            1625-1788           VSFL01002032.1     5554-5717           c
            1789-2001           VSFL01002032.1     1741-1953           c
            2002-2034           VSFL01002032.1     1706-1738           c
FEATURES             Location/Qualifiers
     source          1..2034
                     /organism="Sturnira hondurensis"
                     /mol_type="mRNA"
                     /isolate="20B"
                     /db_xref="taxon:192404"
                     /chromosome="Unknown"
                     /tissue_type="liver"
                     /dev_stage="adult"
                     /ecotype="Veracruz"
     gene            1..>2034
                     /gene="LOC118981214"
                     /note="The sequence of the model RefSeq transcript was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: deleted 2 bases in 1 codon;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 11 Proteins, and 92% coverage of the
                     annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:118981214"
     CDS             1..>2034
                     /gene="LOC118981214"
                     /note="The sequence of the model RefSeq protein was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: deleted 2 bases in 1 codon"
                     /codon_start=1
                     /product="LOW QUALITY PROTEIN: copper-transporting ATPase
                     1-like"
                     /protein_id="XP_036893849.1"
                     /db_xref="GeneID:118981214"
                     /translation="

MLLDALVLGVASLLIAACQECKEEIKVDPNMSVNSVSISVEGMTCSSCVWTIEQQIGKLNGVHHIKVSLEEKNATIIYDPKLQTAETMQEAIDDMGFDAILHNPHPVPVSTDTVCLRVPGSLTAPWDHIQSTLLKAKGVTDINISPQQRSAVVTIIPSLVNAGQIMELVPDLSFDTGTVEKKSGTCEDYRVAPAGEVKLKMKVEGMTCHSCTSTIEGKIGKLQGVQQIKVSLDNQEATVVYQPHLITGEEIKKQIEAAGFPAFIKKQPKYPKLGAIDIERLKNTPVKSSEGSQPRSLACADDYSTATFTIDGMHCKSCVSNIESALSALQYVSSIAVSLENRSAVVKYNANLVTPEALRKAIEAVPPGQYRVSITGGVDSTSNSPSSSCLQKLPLHVVSQPLTQETVINIDGMTCNSCVQSIEGFISKKAGVKSILVSLANSNGTVEYDPLLTSPETLRKAIEDMGFDATLPDTNEPLVVIAQPSSEMPHLTSTNEFHTKMMTPVHDKEDVKTSSKCYIQVTGMTCASCVANIERNLRREEGIYSVLVALMAGKAEVRYNPAVIQPPMIAEFIRELGFGATVIENADEGDGVLELIVRGMTCASCVHKIESTLTKHRGIFYCSVALATNKAHIKYDPEIIGPRDIIHTIEVSATFFVLACLVSIPFEGFWFVSDRGNE"

     misc_feature    112..297
                     /gene="LOC118981214"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(127..135,142..144)
                     /gene="LOC118981214"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    598..786
                     /gene="LOC118981214"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(616..624,631..633)
                     /gene="LOC118981214"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    919..1092
                     /gene="LOC118981214"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(937..945,952..954)
                     /gene="LOC118981214"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1219..1410
                     /gene="LOC118981214"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1237..1245,1252..1254)
                     /gene="LOC118981214"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1555..1743
                     /gene="LOC118981214"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1570..1578,1585..1587)
                     /gene="LOC118981214"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1780..1950
                     /gene="LOC118981214"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1798..1806,1813..1815)
                     /gene="LOC118981214"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
ORIGIN      

atgttgttggatgctcttgttctcggagtcgcctcattactaatagctgcatgccaggaatgtaaagaagaaatcaaagtggatccaaatatgagtgtgaattctgtcagcatctctgtagagggaatgacatgtagttcgtgcgtttggaccattgagcagcagattggaaaactgaatggtgtgcatcacattaaagtctcactggaagaaaaaaatgcaactattatttatgaccctaaactacagactgcagagaccatgcaggaagctatcgatgacatgggcttcgatgctattctccacaatccccaccctgtccctgtttcaaccgacaccgtgtgtctgagagttcctggttcgctgacggcgccatgggaccatatccaaagcacactgctgaaggccaagggtgtcacagacattaatatttcccctcagcaaagaagtgcagtggtgacaataatcccttctttagtgaatgccggtcagataatggagctggttcccgatctcagtttcgacactggaactgtggagaaaaagtcagggacctgtgaagattacagagtggctccagcaggtgaagtcaagctgaagatgaaagtggaggggatgacctgccattcatgcacgagcaccattgaagggaagatagggaaactgcagggtgttcagcaaattaaagtctcccttgacaaccaagaagctactgttgtttatcaacctcatcttatcacaggagaggaaatcaagaagcagattgaagctgcgggctttccagcattcatcaaaaaacagcccaagtaccccaagttgggagctattgatatagaacgtctaaaaaacaccccagtcaaatcttcagaaggatcacagccacggagtctggcatgtgccgatgattattccacagccactttcaccatagatggcatgcattgtaaatcatgtgtgtcaaatattgaaagtgctttatctgcactccaatatgtaagcagcatagcagtttctttagagaatagatctgctgtcgtcaagtacaatgcaaacttagtcactccagaagccctgagaaaagcaatagaggccgtaccaccaggacaatatagagtcagtattacaggtggagttgacagtacctcaaactctccttccagctcctgtcttcagaagcttcccttgcacgtagttagccagcccctgactcaagaaactgtgataaacatcgatggcatgacttgtaactcttgtgtgcagtctattgagggcttcatatcaaaaaaggcaggggtgaaatccatactagtatccctggcaaacagcaatggaactgtagaatacgaccctctgctaacctctccagaaactttgaggaaagcaatagaagacatgggatttgatgctaccttgccagatacaaatgagccattggtagtaatagctcagccctcatcggaaatgccacatttgacctcaactaatgaatttcatactaaaatgatgacaccagttcatgacaaggaggacgtaaagacttcatctaagtgttacatacaggtcactggtatgacctgtgcttcctgtgtagcaaacattgaacggaatttaagacgagaagaaggaatatattctgtactggtggctctgatggctggcaaggcagaagtgagatataatcctgctgttatacaacccccgatgatagccgagttcatccgagagcttggatttggagccactgtgatagaaaatgccgatgaaggggatggtgttttggaacttattgtaagaggaatgacatgtgcatcctgtgtacataaaatagaatctaccctcacaaagcacagagggattttctactgctctgtggccctggcaaccaacaaagcacatattaaatatgatccagaaattattggtcccagagatattatccatacaattgaagtaagtgccactttctttgttcttgcctgtttagtcagcataccctttgaaggcttctggtttgtatcagatagagggaatgaa

//