LOCUS       XM_036536563             869 bp    mRNA    linear   VRT 13-OCT-2020
DEFINITION  PREDICTED: Megalops cyprinoides uncharacterized G-patch domain
            protein DDB_G0278987-like (LOC118782936), mRNA.
ACCESSION   XM_036536563
VERSION     XM_036536563.1
DBLINK      BioProject: PRJNA667936
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Megalops cyprinoides (Indo-Pacific tarpon)
  ORGANISM  Megalops cyprinoides
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Elopiformes; Megalopidae;
            Megalops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_050591.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Megalops cyprinoides Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 9% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..869
                     /organism="Megalops cyprinoides"
                     /mol_type="mRNA"
                     /isolate="fMegCyp1"
                     /db_xref="taxon:118141"
                     /chromosome="9"
                     /tissue_type="whole body"
                     /dev_stage="adult"
                     /country="Singapore"
                     /lat_lon="1.3521 N 103.8198 E"
                     /collection_date="24-Aug-2018"
                     /collected_by="Byrappa Venkatesh"
     gene            1..869
                     /gene="LOC118782936"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 91% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:118782936"
     CDS             60..869
                     /gene="LOC118782936"
                     /codon_start=1
                     /product="uncharacterized G-patch domain protein
                     DDB_G0278987-like"
                     /protein_id="XP_036392456.1"
                     /db_xref="GeneID:118782936"
                     /translation="

MDFTRPKAGGLETDRTAQTIRDGEGVVSGPQDGARDGGASDGYKPSGVSDKTGTSSELKTSGGIGDKTGTQNKSDVIGKKMEPAYSCDSSLSSSDSDDEGYVKEKKKKKKKKKKKHKKKPMSDGKCMFLQVWMCGKTSCAIPVYSLPFSLLQDSSSSSSSSSSSSSSSSSDSSSSSSDSEDEEKYGEKKKKKKKKKKEMKKKEVKDGQDGISDIVIGEGGIELISLEDLSGEERKKEKAKKKKKKKKKKDSGSSSSSDSSSSSSDKTNC"

ORIGIN      

caggttcaggtgagcgaagcggaacctttgcagaattggctggaaagcgctcgaattgaatggatttcacccggcccaaagcgggcgggttggagacggacaggaccgcgcagacgatccgtgacggggagggggtcgtcagcggtcctcaggatggggcgcgggacggcggcgcaagcgatgggtacaaaccttcaggcgtgtcagacaagacgggcactagctccgagctgaagacctctggaggaattggtgacaagacagggacacagaataagagtgatgtcatcgggaaaaagatggagcctgcttattcttgtgatagctcattgtcatcctctgacagtgatgatgaaggatacgtaaaggagaaaaagaagaagaaaaagaagaagaagaagaaacacaagaaaaagcctatgtctgatggaaaatgcatgtttctgcaagtgtggatgtgtgggaagaccagttgtgcaataccagtttactccttgcccttttctcttctacaggactccagctcctcttcctcctcctcctcctcctcctcctcttcctcctcctctgacagctcgtcctcttcctcagacagtgaggatgaggagaagtatggagagaagaagaagaagaaaaagaaaaagaagaaggagatgaagaagaaggaagtaaaagatgggcaggatggcatatctgatattgttataggtgagggaggcatagaattaatatcccttgaagatctaagcggtgaagagagaaagaaagagaaggcaaagaagaagaagaagaagaagaagaagaaggactctggctcatcttcctcctctgatagctcctcctcttcttcggacaagacaaactgctga

//