2024-05-19 07:34:07, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_033507628 3772 bp mRNA linear INV 16-APR-2020 DEFINITION PREDICTED: Bombus vosnesenskii copper-transporting ATPase 1 (LOC117241664), transcript variant X8, mRNA. ACCESSION XM_033507628 VERSION XM_033507628.1 DBLINK BioProject: PRJNA623919 KEYWORDS RefSeq. SOURCE Bombus vosnesenskii ORGANISM Bombus vosnesenskii Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Bombus; Pyrobombus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_022884330.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Bombus vosnesenskii Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3772 /organism="Bombus vosnesenskii" /mol_type="mRNA" /isolate="JDL3184/JDL3185" /isolation_source="2 male haploid bees from laboratory colony" /db_xref="taxon:207650" /chromosome="Unknown" /sex="male" /tissue_type="muscle" /dev_stage="adult" /country="USA: Oregon, Jackson County, Emigrant Lake" /lat_lon="42.15236 N 122.62105 W" /collection_date="26-Mar-2015" /collected_by="Jonathan Koch" /identified_by="James Strange" gene 1..3772 /gene="LOC117241664" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 66 samples with support for all annotated introns" /db_xref="GeneID:117241664" CDS 59..3772 /gene="LOC117241664" /codon_start=1 /product="copper-transporting ATPase 1 isoform X5" /protein_id="XP_033363519.1" /db_xref="GeneID:117241664" /translation="
MVYVPRSQKMKDSTNISTMKVNIDGMRCQSCVKNIERTIGSRPEVLSVKVILEEKLGYIEFKAEEITPNELVEAIEDMGFTASLCSDESSSTEKIQRSDSLQLTISTCTVHIDGMTCASCVKTIIDSLSQKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFVEEMGFNSFVKEVNGKVLGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDIVSSISELGFPTTLIEEPGTGEGDIELKITGMTCASCVNKIESTVRKLPGVRSAAVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLFVWIIVGYVNVNSLPISHNDQIKKHGLNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSETTGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVIEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETSEYLSAMHAHSTARMIDLDTISLHRGLDDTVMPIMHRSTSTLSRLFRRSKDNVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"
misc_feature 116..307 /gene="LOC117241664" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(134..142,149..151) /gene="LOC117241664" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 392..565 /gene="LOC117241664" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(401..409,416..418) /gene="LOC117241664" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 725..907 /gene="LOC117241664" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(734..742,749..751) /gene="LOC117241664" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 944..1132 /gene="LOC117241664" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(962..970,977..979) /gene="LOC117241664" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1211..3472 /gene="LOC117241664" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2204..2206,2210..2212,3341..3343) /gene="LOC117241664" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(2336..2344,2546..2548,2792..2800,2888..2890, 3008..3016,3074..3076,3083..3085,3092..3094,3149..3151, 3158..3160) /gene="LOC117241664" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" misc_feature order(3344..3346,3425..3427,3437..3439) /gene="LOC117241664" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" ORIGIN
ttcggttgcataatgcaacgatggggagggcgataccgattacgaaggcacggtacagatggtgtacgttcctcggtcgcagaaaatgaaagattccacgaatatttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagagaaccataggtagccgaccggaggttttaagcgttaaagtaatcctagaagagaagctcggctacatcgaatttaaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggtttcaccgcttccctatgcagcgacgaaagtagctctaccgaaaagatacaaagaagtgattcgttacaattaactatcagtacttgtaccgtacatatcgatggaatgacttgcgcgtcttgtgttaaaactatcattgacagtttatcgcagaaagcaggaataaaacaggcgaacgttagtttagagaagaaggaagctacggtttcttacaacgacaaggacctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttctaggagaggaaacaccaatgaatttatcgttaaaaaacaattccgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcaaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgtcgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtagcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgattgacatcgtttctagcatatcggaattgggcttccctactactttgatcgaggaacctggcactggagagggagatatcgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattaccgggcgtccgttctgccgctgttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttagtaataaagataaagagaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgtttttagtgtccttaatttttggcataccgtgtatgttagccatgacatacttcatggtaatcatgtctattggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtgcagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagctatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacatcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgagcgtttgatcagtatagatttagtacaacggggcgatgtcctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtaccgaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaatcactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagcggataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttattcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaaaaaacacggattgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcgatagcttgtccatgcgcgttaggattggctacaccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaaatgtattgtatttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttagtcattatctgtacagctgaaacaaacagcgaacatccgatcgcatcagcaattgtgcggtacgtgaaggaaacaataggctctgaaacaactggacagtgcatgaattttcaagcagtcgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaggtaaaaagattaccttctggaacgcataacttaaataatgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttattgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaagatgggtctagaagtcattcttttaacaggagataatagaaagactgctgtttctatcgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgcaatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaatgatcttctagatgttatcgcgtgtctggatctatcgagaaaaacagttcgtcgaataaggttgaattttttatttgctagtatctataatttgttgggtattcctattgctgctggaatatttagttctttcggattcttccttcaaccttggatgtcgtcagcggcgatggctttaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccgacaaagaccactttagaaacatcagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatttagatacaatatctcttcatcgtggtttagatgatactgtaatgcctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacaatgtagagggtcgtctcctaggtgaagatattgatgaaattgatttggtaactgatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]