LOCUS       XM_033507623            4328 bp    mRNA    linear   INV 16-APR-2020
DEFINITION  PREDICTED: Bombus vosnesenskii copper-transporting ATPase 1
            (LOC117241664), transcript variant X3, mRNA.
ACCESSION   XM_033507623
VERSION     XM_033507623.1
DBLINK      BioProject: PRJNA623919
KEYWORDS    RefSeq.
SOURCE      Bombus vosnesenskii
  ORGANISM  Bombus vosnesenskii
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Bombus; Pyrobombus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022884330.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bombus vosnesenskii Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4328
                     /organism="Bombus vosnesenskii"
                     /mol_type="mRNA"
                     /isolate="JDL3184/JDL3185"
                     /isolation_source="2 male haploid bees from laboratory
                     colony"
                     /db_xref="taxon:207650"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="USA: Oregon, Jackson County, Emigrant Lake"
                     /lat_lon="42.15236 N 122.62105 W"
                     /collection_date="26-Mar-2015"
                     /collected_by="Jonathan Koch"
                     /identified_by="James Strange"
     gene            1..4328
                     /gene="LOC117241664"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 19 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:117241664"
     CDS             453..4328
                     /gene="LOC117241664"
                     /codon_start=1
                     /product="copper-transporting ATPase 1 isoform X2"
                     /protein_id="XP_033363514.1"
                     /db_xref="GeneID:117241664"
                     /translation="

MESEINTKTLIDDNHQLNKISTEQADRENAANAELTVTKKDDGEGDTDYEGTVQMVYVPRSQKMKDSTNISTMKVNIDGMRCQSCVKNIERTIGSRPEVLSVKVILEEKLGYIEFKAEEITPNELVEAIEDMGFTASLCSDESSSTEKIQRSDSLQLTISTCTVHIDGMTCASCVKTIIDSLSQKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFVEEMGFNSFVKEVNGKVLGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDIVSSISELGFPTTLIEEPGTGEGDIELKITGMTCASCVNKIESTVRKLPGVRSAAVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLFVWIIVGYVNVNSLPISHNDQIKKHGLNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSETTGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVIEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETSEYLSAMHAHSTARMIDLDTISLHRGLDDTVMPIMHRSTSTLSRLFRRSKDNVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"

     misc_feature    672..863
                     /gene="LOC117241664"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(690..698,705..707)
                     /gene="LOC117241664"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    948..1121
                     /gene="LOC117241664"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(957..965,972..974)
                     /gene="LOC117241664"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1281..1463
                     /gene="LOC117241664"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1290..1298,1305..1307)
                     /gene="LOC117241664"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1500..1688
                     /gene="LOC117241664"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1518..1526,1533..1535)
                     /gene="LOC117241664"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1767..4028
                     /gene="LOC117241664"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2760..2762,2766..2768,3897..3899)
                     /gene="LOC117241664"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2892..2900,3102..3104,3348..3356,3444..3446,
                     3564..3572,3630..3632,3639..3641,3648..3650,3705..3707,
                     3714..3716)
                     /gene="LOC117241664"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     misc_feature    order(3900..3902,3981..3983,3993..3995)
                     /gene="LOC117241664"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
ORIGIN      

tgctgatgccgaagtactaacaattcagtgtgataaatgtgaatagaaacctattgtctatctattgcctgtgctgatatttacatagtttattactaatcgaatccattaatttcggtttaactatgaattttttataggttagattacatttattaagcaattctgatagtatccagttagaacagtgtatagaacaagaatccgtttaacctaataagttttgtaaacttattttagatcgcatgtttatatatatatttttgttttttttattactttatcaaaagtaaagtgtatgttcacaattgtaatcggtaaataagattttgccagtaatgtattcctctctgatggtgcattatgtgtgtaagataatgaaaaaagtgaatcataaattaaactgttcactttgatgaaaacattttattttcaaatttgatattattgaaatggaatcagaaattaatacaaagacattaatagatgacaatcatcagcttaataaaatcagtacagaacaggctgacagggaaaatgcggcaaatgcagagctgacagtaacaaaaaaagacgatggggagggcgataccgattacgaaggcacggtacagatggtgtacgttcctcggtcgcagaaaatgaaagattccacgaatatttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagagaaccataggtagccgaccggaggttttaagcgttaaagtaatcctagaagagaagctcggctacatcgaatttaaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggtttcaccgcttccctatgcagcgacgaaagtagctctaccgaaaagatacaaagaagtgattcgttacaattaactatcagtacttgtaccgtacatatcgatggaatgacttgcgcgtcttgtgttaaaactatcattgacagtttatcgcagaaagcaggaataaaacaggcgaacgttagtttagagaagaaggaagctacggtttcttacaacgacaaggacctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttctaggagaggaaacaccaatgaatttatcgttaaaaaacaattccgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcaaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgtcgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtagcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgattgacatcgtttctagcatatcggaattgggcttccctactactttgatcgaggaacctggcactggagagggagatatcgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattaccgggcgtccgttctgccgctgttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttagtaataaagataaagagaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgtttttagtgtccttaatttttggcataccgtgtatgttagccatgacatacttcatggtaatcatgtctattggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtgcagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagctatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacatcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgagcgtttgatcagtatagatttagtacaacggggcgatgtcctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtaccgaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaatcactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagcggataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttattcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaaaaaacacggattgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcgatagcttgtccatgcgcgttaggattggctacaccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaaatgtattgtatttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttagtcattatctgtacagctgaaacaaacagcgaacatccgatcgcatcagcaattgtgcggtacgtgaaggaaacaataggctctgaaacaactggacagtgcatgaattttcaagcagtcgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaggtaaaaagattaccttctggaacgcataacttaaataatgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttattgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaagatgggtctagaagtcattcttttaacaggagataatagaaagactgctgtttctatcgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgcaatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaatgatcttctagatgttatcgcgtgtctggatctatcgagaaaaacagttcgtcgaataaggttgaattttttatttgctagtatctataatttgttgggtattcctattgctgctggaatatttagttctttcggattcttccttcaaccttggatgtcgtcagcggcgatggctttaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccgacaaagaccactttagaaacatcagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatttagatacaatatctcttcatcgtggtttagatgatactgtaatgcctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacaatgtagagggtcgtctcctaggtgaagatattgatgaaattgatttggtaactgatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatga

//