LOCUS       XM_033447634            4189 bp    mRNA    linear   INV 16-APR-2020
DEFINITION  PREDICTED: Bombus bifarius copper-transporting ATPase 1
            (LOC117207418), transcript variant X6, mRNA.
ACCESSION   XM_033447634
VERSION     XM_033447634.1
DBLINK      BioProject: PRJNA623924
KEYWORDS    RefSeq.
SOURCE      Bombus bifarius
  ORGANISM  Bombus bifarius
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Bombus; Pyrobombus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022884401.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bombus bifarius Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4189
                     /organism="Bombus bifarius"
                     /mol_type="mRNA"
                     /isolate="JDL3187"
                     /db_xref="taxon:103933"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /country="USA: Eldora, Boulder County, Colorado"
                     /lat_lon="39.94 N 105.56 W"
                     /collection_date="03-Sep-2018"
                     /identified_by="Jeff Lozier"
     gene            1..4189
                     /gene="LOC117207418"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 17 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:117207418"
     CDS             377..4189
                     /gene="LOC117207418"
                     /codon_start=1
                     /product="copper-transporting ATPase 1 isoform X4"
                     /protein_id="XP_033303525.1"
                     /db_xref="GeneID:117207418"
                     /translation="

MRKFAKTWRYKLLNSTKYLGDGEGDTDYEGTVQMVYVPRSQKMKDSTNISTMKVNIDGMRCQSCVKNIERTIGSRPEVLSVKVILEEKLGYIEFKAEEITPNELVEAIEDMGFTASLCSDESSSTEKIQRSDSLQLTISTCTVHIDGMTCASCVKTIIDSLSQKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFVEEMGFNSFVKEVNGKVLGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDIASSISELGFPTTLIEEPGTGEGDIELKITGMTCASCVNKIESTVRKLPGVRSAAVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLFVWIIVGYVNVNSLPISHNDQIKKHGLNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSETTGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKKLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVIEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETSEYLSAMHAHSTARMIDLDTISLHRGLDDTVMPIMHRSTSTLSRLFRRSKDNVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"

     misc_feature    533..724
                     /gene="LOC117207418"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(551..559,566..568)
                     /gene="LOC117207418"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    809..982
                     /gene="LOC117207418"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(818..826,833..835)
                     /gene="LOC117207418"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1136..1330
                     /gene="LOC117207418"
                     /note="copper chaperone CopZ; Region: chaper_CopZ_Eh;
                     NF033794"
                     /db_xref="CDD:411374"
     misc_feature    1361..1549
                     /gene="LOC117207418"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1379..1387,1394..1396)
                     /gene="LOC117207418"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1628..3889
                     /gene="LOC117207418"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2621..2623,2627..2629,3758..3760)
                     /gene="LOC117207418"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2753..2761,2963..2965,3209..3217,3305..3307,
                     3425..3433,3491..3493,3500..3502,3509..3511,3566..3568,
                     3575..3577)
                     /gene="LOC117207418"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     misc_feature    order(3761..3763,3842..3844,3854..3856)
                     /gene="LOC117207418"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
ORIGIN      

aaaagtaatacatataagttggtcgtatcgaagacgaaaataacgcgcgatagttttgaaaattaaacgacaatgctttgatgacgaaacgcgaagaacagaagaatgttattgagtgctcgtatttcaaaaagcacttggtgactcgcagtagttttattttctaatcgacacagagggatagatggattcgaaatttgatcgtgatctgttgatcgttcaaacctataagtgtgtaacgaacgtatttccttcgctttgcctatcgaataaccccaattttatcgccagtcaattcgtaaaacattatgctatcgtgacgttctttacattttaacgattactatttcgatttattttatgcaatcgtatcgtaatgcggaagttcgcaaaaacgtggcggtataaattactgaattctacaaaatacttgggcgatggggagggcgataccgattacgaaggcacggtacagatggtgtacgttcctcggtcgcagaaaatgaaagattccacgaatatttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagagaaccataggaagccgaccggaggttttaagcgttaaagtaatcctagaagagaagctcggctacatcgaatttaaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggtttcaccgcttccctatgcagcgacgaaagtagctctaccgaaaagatacaaagaagtgattcgttacaattaactatcagtacttgtaccgtacatatcgatggaatgacttgcgcgtcttgtgttaaaactatcattgacagtttatcgcagaaagcaggaataaaacaggcgaacgttagtttagagaagaaggaagctacggtttcctacaacgacaaggacctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttctaggagaggaaacaccaatgaatttatcgttaaaaaacaattctgctcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcaaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgtcgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtagcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgattgacatcgcttctagcatatcggaattgggcttccctactactttgatcgaggaacctggcactggagagggagatatcgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattaccgggcgtccgttctgccgctgttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttagtaataaagataaagagaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgtttttagtgtccttaatttttggcataccgtgtatgttagccatgacatacttcatggtaattatgtctattggtgaaaaaacgcatgaagatatgtgttgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtccagttttttggtggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagctatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacatcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgaacgtttgatcagtatagatttagtacaacggggcgatgtcctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtaccgaaaaagaaaggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaattactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagccgataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttattcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaaaaaacacggattgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcgatagcttgtccatgcgcgttaggattggctacgccaactgctgttatggttggtaccggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgctcacaaagttaaatgtattgtatttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttagtcattatctgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcggtacgtgaaggaaacaataggctctgaaacaactggacagtgcatgaattttcaagcagttgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaggtaaaaaaattaccttctggaacgcataacttaaataatgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttattgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaagatgggtttagaagtcattcttttaacaggagataatagaaagactgctgtttctatcgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgcaatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaatgatcttctagatgttatcgcgtgtctggatctatcgagaaaaacagttcgtcgaataaggttgaattttttatttgctagtatctataatttgttgggtattcctattgctgctggaatatttagttctttcggattcttccttcaaccttggatgtcgtcagcggcgatggctttaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccgacgaagaccactttagaaacatcagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatttagatacaatatctcttcatcgtggtttagatgatactgtaatgcctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacaatgtagagggtcgtctcctaggtgaagatattgatgaaattgatttggtaacagatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatga

//