LOCUS       XM_026158436            1975 bp    mRNA    linear   VRT 04-SEP-2018
DEFINITION  PREDICTED: Astatotilapia calliptera copper-transporting ATPase
            2-like (LOC113015998), mRNA.
ACCESSION   XM_026158436
VERSION     XM_026158436.1
DBLINK      BioProject: PRJNA488811
KEYWORDS    RefSeq.
SOURCE      Astatotilapia calliptera (eastern happy)
  ORGANISM  Astatotilapia calliptera
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Cichlomorphae; Cichliformes;
            Cichlidae; African cichlids; Pseudocrenilabrinae; Haplochromini;
            Astatotilapia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_039323.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Astatotilapia calliptera Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1975
                     /organism="Astatotilapia calliptera"
                     /mol_type="mRNA"
                     /db_xref="taxon:8154"
                     /chromosome="23"
     gene            1..1975
                     /gene="LOC113015998"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:113015998"
     CDS             3..1403
                     /gene="LOC113015998"
                     /codon_start=1
                     /product="copper-transporting ATPase 2-like"
                     /protein_id="XP_026014221.1"
                     /db_xref="GeneID:113015998"
                     /translation="

MTLKENDHDIEKQGFENLAYEYGSQTELCPPPKAASRASFKLQRITSEHEVHIIQTRICSLNGIIAVTWSVPNSLAKVDYDASVIPTKEIALELQTLGYSVESVVQIRVDGMHCQSCVQSIQGQIGELQGVSHIQVSLQDKAALIVFQPLLVTHEELRDKIEDMGFDTALLSEDPSVEDLSFWQKKEVDASTQTVTILIGGMTCSSCVQTIEERISQMTGVRFIAVSLEAEKGTITFDPYLTEPEQLRAAIEDMGFDASLKEPIKSVQSHEKSQPVSFGLSDMSTNRPVVSNGTGSQVPSASSPEIKAQKCFICVTGMTCASCVSNIERNLLKHRGIFSVLVSLMAGKAEVKYDSHVLDATAVTELIKDLGFGAKVIEDNAVAHGKLDLTITGMTCASCVHNIESKLNLTRGILMASVALATNKAQVEFDPEVLGPRDIIKLIQGLGFEARLATWQRPQQTMWKST"

     misc_feature    318..503
                     /gene="LOC113015998"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(336..344,351..353)
                     /gene="LOC113015998"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    588..779
                     /gene="LOC113015998"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(606..614,621..623)
                     /gene="LOC113015998"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    945..1127
                     /gene="LOC113015998"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(954..962,969..971)
                     /gene="LOC113015998"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1164..1355
                     /gene="LOC113015998"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1182..1190,1197..1199)
                     /gene="LOC113015998"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
ORIGIN      

gtatgaccctgaaggagaatgaccatgacattgagaaacaaggctttgaaaacctggcctacgagtatgggagccaaactgagctctgccctccacctaaagctgcctcaagagcatcttttaaacttcagcggatcacctctgagcatgaggtccacatcatccaaaccagaatctgcagcctgaatggaataattgctgtcacatggtctgtacccaacagtttggccaaggtggactatgatgcttcagttattccaaccaaagagatcgccctggaactacagaccttgggatacagcgtggagtctgtggtgcagatcagggtggatggtatgcactgccagtcctgtgtgcagtccattcagggacagatcggggagctgcagggggtttcacatattcaggtgtctcttcaggacaaagcagcgctgattgtttttcagcctcttctagtcacacatgaagagctgagagacaaaattgaggacatgggctttgatactgctttgttatctgaggacccatcagtagaagatttaagtttctggcagaaaaaggaggtggatgcctccacccagactgtaaccattttgattggagggatgacttgcagctcttgtgtgcagacaatagaagagaggatctctcagatgactggagtgcggttcatagcggtgtccctggaggcggaaaagggaacaataacctttgatccctatttaacagagccagagcagctcagggcagctattgaggacatgggctttgacgcctcacttaaagaacctataaagagtgttcagagtcatgaaaagtcccagcctgtaagctttggactttctgacatgtcgacaaacaggcctgtagtcagcaatgggacgggttcacaggtaccatctgcaagttcgcctgagataaaagcacagaaatgcttcatctgcgttacggggatgacctgtgcctcctgtgtgtccaacatcgagaggaacctgctcaaacacagaggaatcttctcagtgttggtgtcgctaatggccggtaaggcagaggtgaagtatgattcacatgtcctggatgctactgcagtgactgagctcatcaaagacttgggctttggtgccaaagtgattgaggataatgcagtagcacatggaaagctggacctcactataacaggcatgacgtgcgcatcatgtgtccacaacatcgagtccaagctcaacttaaccagagggatcctcatggcttcggtcgcactggcaaccaacaaagctcaggttgagtttgacccagaggtgctcggacctcgggatattatcaagctcatccagggtcttggatttgaggccaggctggctacatggcagcgtccccagcaaaccatgtggaagtcaacctgaccgcgtagctactcatgcagcaagacaaaccttggagctcctgcaaactttattcacaaactgcaactattttacacaaatctgcgactgacaacaagcacagagacttcaaacaatcactgaaagaaaccaaatcctgcgtctttgccttgacagacgcctaaaatggctcgagctgtggcaaaggagaagctcccacactcatccagtggagaccgttgtgctctggacaatgaagttcccgctttcatgttcagacctatcagtgcacctgcatgtgagctcccaagtccaccacctgctgatgccagctttcattcaaaggacacaaacaagatcattcacccagatttgaaaaatgatcgttcatccctggatgatgaagtggcgtttttcatgtgtcctactgatgttcctctgcctccgagacctccacccactgcagagttacgtctctgcagaaagcgcagacattctgctgttttttctgtggaggatgaagaggaacatttgatgcctaaacgcatgaggctgatgagttctgatgttccagtttcttcagttcctccacc

//