LOCUS       XM_023354990             956 bp    mRNA    linear   INV 22-DEC-2017
DEFINITION  PREDICTED: Centruroides sculpturatus copper chaperone for
            superoxide dismutase-like (LOC111613636), transcript variant X2,
            mRNA.
ACCESSION   XM_023354990
VERSION     XM_023354990.1
DBLINK      BioProject: PRJNA422877
KEYWORDS    RefSeq.
SOURCE      Centruroides sculpturatus (bark scorpion)
  ORGANISM  Centruroides sculpturatus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida;
            Scorpiones; Buthida; Buthoidea; Buthidae; Centruroides.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019386107.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Centruroides sculpturatus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..956
                     /organism="Centruroides sculpturatus"
                     /mol_type="mRNA"
                     /isolate="CEXI.00-Female"
                     /db_xref="taxon:218467"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="whole organism"
                     /collection_date="01-Feb-2012"
                     /note="non-domesticated species of scorpion"
     gene            1..956
                     /gene="LOC111613636"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 58 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 6 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:111613636"
     CDS             110..841
                     /gene="LOC111613636"
                     /codon_start=1
                     /product="copper chaperone for superoxide dismutase-like
                     isoform X2"
                     /protein_id="XP_023210758.1"
                     /db_xref="GeneID:111613636"
                     /translation="

MTCQSCVNSVERALRNLDVKKVEIDLNNQQVVVETSLPYSEILHHIEQTGRRAVLKGYGSISGGAAVAEIFGKNGIMGIVRFAHINDSSCIIDGTVDGLKGEHGLHICEFGDLTNDCENVGGHYNPSNKMHGSPEDNERHYGDLGNIRADKNGRAVFRKEDSTVKVWEIIGRSLVITEHKDDLGRGNNERSKIDGNSGQKLACGIIARSAGLFQNPKRICLCDGVSVWDEREKPVAGESRAKY"

     misc_feature    110..796
                     /gene="LOC111613636"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      

acgcaccatcatttcgctgccatgtttgaacggaaagcgccactgtttacaaagtgtgccccctgccaatatttctgcttgcctgtattgacttgagtttgatgttgaaatgacttgtcagtcatgcgttaattcagtagagagagctcttcggaatttggatgtaaagaaagtcgagattgacttgaataaccaacaagttgtggtagaaaccagtcttccttattcggagattctacatcacattgaacagaccggacgacgggcagtcttgaagggttatggatcaatttcaggtggagcagcagtagctgaaatctttggaaaaaatggcataatgggaattgtcagatttgcacatataaatgatagcagttgtattattgacggaacagttgatggcttaaagggagaacacggtcttcacatatgtgaatttggagatttgacaaatgactgtgagaatgttggaggacattataatccgagtaataaaatgcatggaagtccagaagataatgaaagacattatggagatttagggaatattagagcagataaaaatggaagagcagtttttaggaaagaagattcaacagtgaaagtgtgggaaattattgggcgctcattagttatcacagaacataaagatgatttaggaagaggaaacaatgagagatcaaaaattgatggaaattcaggacaaaaactagcatgtggtattattgcaagatctgctggacttttccagaatccaaaaagaatatgtctttgtgatggtgtatctgtctgggatgaaagggagaaacctgttgctggagagagcagggcaaaatattaatagtttaattattcagttgctattatgaaaaatattattaatttcagttatttatatatacataataataaaagatttgaaagtattattgtaaatactacacaaactactcatt

//