LOCUS       XM_022980291            1330 bp    mRNA    linear   INV 04-NOV-2017
DEFINITION  PREDICTED: Spodoptera litura copper-transporting ATPase 1-like
            (LOC111363465), partial mRNA.
ACCESSION   XM_022980291
VERSION     XM_022980291.1
DBLINK      BioProject: PRJNA416314
KEYWORDS    RefSeq.
SOURCE      Spodoptera litura
  ORGANISM  Spodoptera litura
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata;
            Ditrysia; Noctuoidea; Noctuidae; Amphipyrinae; Spodoptera.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019224876.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Spodoptera litura Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1330
                     /organism="Spodoptera litura"
                     /mol_type="mRNA"
                     /strain="Ishihara"
                     /db_xref="taxon:69820"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="whole body"
                     /dev_stage="moths"
     gene            <1..>1330
                     /gene="LOC111363465"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 16 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:111363465"
     CDS             <1..>1330
                     /gene="LOC111363465"
                     /codon_start=2
                     /product="copper-transporting ATPase 1-like"
                     /protein_id="XP_022836059.1"
                     /db_xref="GeneID:111363465"
                     /translation="

ESSAELVAVRVPINGMTCMSCVRSIEGSVRELPGIAYVKVELSENAGYFRYEPRTISEEAIRSHIEDMGFEVPTDTTEHETRNLLPKEIPTDLLIDMSGTGEMDEQEVLLSVVGMTCQSCVNTIEGALRELSGVRSVSVRLSEGTARIRYVRGTTTARQLADTVYALGFSVTVLAVDGDQYTETTSQSKSEEGSGDGAKPPSPVKSRAQINGSPPVAEGETSRCTLEVRGMTCASCVAAIEKHVQKLYGVHSILVALLAAKAEVKYSPAKISAADIANCITELGFPSSVISDCDGSGQKDLHVAIKGMTCASCVNKIEKSVLKLTGVVSCTVALTTCKGKIKYNAEQIGPRTICEAINNLGFDASVVTPHNRGTTNYLEHKEEIKKWRNAFLISLLFGGPCMVAMAYFMAAMSRGHSARDMCCVLPGLSLDNLIMFLLSTPVQ"

     misc_feature    32..217
                     /gene="LOC111363465"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(47..55,62..64)
                     /gene="LOC111363465"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    329..517
                     /gene="LOC111363465"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(344..352,359..361)
                     /gene="LOC111363465"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    674..865
                     /gene="LOC111363465"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(692..700,707..709)
                     /gene="LOC111363465"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    908..1102
                     /gene="LOC111363465"
                     /note="copper chaperone CopZ; Region: chaper_CopZ_Eh;
                     NF033794"
                     /db_xref="CDD:411374"
     misc_feature    914..>1330
                     /gene="LOC111363465"
                     /note="Cation transport ATPase [Inorganic ion transport
                     and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:225127"
ORIGIN      

agagtcgagcgcggagctggtggcggtccgagtgcctataaatggcatgacctgcatgtcctgcgtccgcagcatcgagggatccgtcagagagcttcctggcatcgcttatgttaaggtggaactatcagaaaacgcaggctacttcagatatgagccgcgaaccatctcggaggaggctatccggtctcatatagaagacatgggcttcgaggtgcccactgacaccacggaacacgaaaccagaaacctgttacccaaagagataccgactgacctcttaatcgacatgtctggcacgggcgagatggatgagcaggaggtcctgttgtcagtcgtcggcatgacctgccagtcctgtgtcaatactattgagggcgctctccgcgagctttcaggcgttagatcagtatcagtgcgtctatcagagggcacggcacggatccgatacgtccgcggtacgactacggcacgacaactcgccgataccgtgtatgctctcggattctctgttactgtgttagctgttgatggggatcagtacacagaaacgacttcacaaagcaagagcgaggaaggatcaggtgatggagcgaaaccaccttctccggtcaagagtagagcacaaattaatgggtccccgccagtagctgaaggtgaaacgtctcgctgtacgttagaagtccgcggcatgacgtgcgcctcctgtgtcgcagccatagagaaacatgttcagaagttgtatggtgttcactcaatcctagtagctcttctagcagctaaagcagaagtgaaatactctcccgcaaagatatcagcggcggacatcgccaactgtatcaccgaacttggcttcccatccagtgtgattagtgactgcgatggcagtggacagaaggatctacatgttgctataaaaggcatgacttgcgcgtcctgtgtcaacaaaatagagaagagtgttctgaaactaaccggagttgtatcctgtactgtagcattgactacttgcaaaggtaagataaaatacaacgccgagcagataggtccgcgcactatatgcgaagcgatcaacaacctcgggttcgatgccagcgtcgtgacaccgcataacagaggcactactaattatttggaacataaagaagaaataaagaaatggcggaacgcgttcctgatatctctgctgttcggcgggccgtgcatggtggccatggcgtacttcatggcggccatgtcgcgcggccacagcgcccgcgacatgtgctgcgtgctgccgggcctgagcctcgacaacttgatcatgttcctgctctccacgcccgtccag

//