ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-19 10:32:44, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_022464324 5350 bp mRNA linear INV 14-SEP-2017
DEFINITION PREDICTED: Crassostrea virginica copper-transporting ATPase 1-like
(LOC111122539), mRNA.
ACCESSION XM_022464324
VERSION XM_022464324.1
DBLINK BioProject: PRJNA379157
KEYWORDS RefSeq; corrected model.
SOURCE Crassostrea virginica (eastern oyster)
ORGANISM Crassostrea virginica
Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae;
Crassostrea.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_035782.1) annotated using gene prediction method: Gnomon,
supported by EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Version :: Crassostrea virginica Annotation
Release 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 7.4
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
##RefSeq-Attributes-START##
frameshifts :: corrected 1 indel
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-126 MWPT03000003.1 63401867-63401992 c
127-248 MWPT03000003.1 63399067-63399188 c
249-1338 MWPT03000003.1 63394373-63395462 c
1339-1560 MWPT03000003.1 63394045-63394266 c
1561-1724 MWPT03000003.1 63392169-63392332 c
1725-1784 MWPT03000003.1 63392013-63392072 c
1785-1785 "N" 1-1
1786-1886 MWPT03000003.1 63391912-63392012 c
1887-1966 MWPT03000003.1 63391699-63391778 c
1967-2204 MWPT03000003.1 63391354-63391591 c
2205-2438 MWPT03000003.1 63391006-63391239 c
2439-2579 MWPT03000003.1 63390358-63390498 c
2580-2688 MWPT03000003.1 63389952-63390060 c
2689-2813 MWPT03000003.1 63389707-63389831 c
2814-2948 MWPT03000003.1 63389478-63389612 c
2949-3140 MWPT03000003.1 63389167-63389358 c
3141-3323 MWPT03000003.1 63388888-63389070 c
3324-3531 MWPT03000003.1 63388344-63388551 c
3532-3693 MWPT03000003.1 63387908-63388069 c
3694-3836 MWPT03000003.1 63387126-63387268 c
3837-4040 MWPT03000003.1 63386786-63386989 c
4041-4158 MWPT03000003.1 63386414-63386531 c
4159-4261 MWPT03000003.1 63386204-63386306 c
4262-5350 MWPT03000003.1 63385000-63386088 c
FEATURES Location/Qualifiers
source 1..5350
/organism="Crassostrea virginica"
/mol_type="mRNA"
/isolate="RU13XGHG1-28"
/isolation_source="Rutgers Haskin Shellfish Research
Laboratory inbred lines (NJ)"
/db_xref="taxon:6565"
/chromosome="3"
/tissue_type="whole sample"
/country="USA"
/collection_date="22-Mar-2015"
gene 1..5350
/gene="LOC111122539"
/note="The sequence of the model RefSeq transcript was
modified relative to its source genomic sequence to
represent the inferred CDS: inserted 1 base in 1 codon;
Derived by automated computational analysis using gene
prediction method: Gnomon. Supporting evidence includes
similarity to: 1 EST, 3 Proteins, and 98% coverage of the
annotated genomic feature by RNAseq alignments, including
14 samples with support for all annotated introns"
/db_xref="GeneID:111122539"
CDS 120..4511
/gene="LOC111122539"
/note="The sequence of the model RefSeq protein was
modified relative to its source genomic sequence to
represent the inferred CDS: inserted 1 base in 1 codon"
/codon_start=1
/product="LOW QUALITY PROTEIN: copper-transporting ATPase
1-like"
/protein_id="XP_022320032.1"
/db_xref="GeneID:111122539"
/translation="
MLGEETQEMEKVTDLHIEGMTCQSCIDKIQDHMAREPGVIHVQMFLEEKEAKITYSPTETSPPILAEQISDMGFPSKVKLVHPVRGDNCQDAIINVGGMTCQSCVKSIESKMLEVSGILGITVSLLKKQAYVQFNPGKISAESIASAIDDMGFEASVHSITRDKGLTTKIGVEGMTCQSCVNSIESAMRGKPGVREIKVSLSDKEAHIVYDPTLTSPGSLRDQIDDMGFEATLARESSIESEFDRLASRQSSTRSVQSELVCQIAVKGMTCQSCVKNIESNISPKPGVMSISVSLEKEMASVTYNPLVTNPTSIAGMIDDMGFEASVEGSDAEPSTDTVVVGVEGMTCHSCVKSIEEHISKNPAVKSIKVSLADQNANIEYYPNRATPSTLRDAIDDMGFTASLPTDDVAVKVVQPKKSSGIKPKSPSESLKIELDKGAVSFRKGGDIVDDDLEKCFLRVTGMTCASCVATIEKNLMKVEGIHSCLVALMAQKAEVKYDPAYLLPSQIAAKISSLGFEATVLESEGFGQGVVELLITGMTCSSCVHMIESSIMKKXGVIQASVALSTCKGKFTYNPEVTGPRAIIEAIKSLGYQAELYTDDDKDAARYDHRDEIKRWRTSFLWSLIFGVPSVVIMMYFMFTPPPEEHNSVTNTTAGNYTTTHKPQTSSEGHYQIMIVAGLSLDNLLMFILATPVQFIGGRYFYIQAFKALRHGAANMDVLVVLATTISYVYSCVVVIVAMIMKEKTSPVTFFETTPMLMVFISLGRWLEHVAKGKTSEALAKLMSLQASEAVLVEIDKEFNILNEQTINVDLVQRGDVLKVVPGEKIPVDAKIIEGTTTCDESLITGESMPVSKKPGSSVIGGSINQHGMILVQATHVGSDTTLSQIVKLVEEAQTSKAPIQQLADKIAGYFVPGVVILSTLTVIAWAIVGYVDVTKVMPDFVNDGTISRDEVIFQKAFQYAITVLSIACPCALGLATPTAVMVGTGVGATNGILIKGGEPLECSHKLKCIVFDKTGTVTHGVPRVARVAMFVENSICSFVKLIAIAGTAENSSEHPLASAIVKYAKQTLKTETLGKTQNYQAVPGCGLKCTVTQIDGILVDIDMEGVNNRKNLMGSTRVKTDNVLYDGEEISATIEESSLVGAVASRPYDVLIGNREWMTRNGLIVTDKMDETMTEHEHQGQTAILCAIDGKIIAMLAVADTVKSEAHLAISVLKDMGLQVVLLTGDNQKTARAIARQIGIHKVFAEVLPSHKVKKIKQLQKQGMKVAMVGDGVNDSPALAQADVGIAIGTGTDVAVEAADVVLIKNDLLDVAAAIQLSKKTVRRIRINFFAASIYNLIGIPIAAGIFVPWGLSLKPWMASAAMAMSSVSVVFSSLLLKTFKKPNKEKMLTPKYYAKFAADQELDNISVHRGVESLPSSREGSKQGSIISRLSGRKKPTTPDHTSLLEMGENSDSDSSDQLG"
misc_feature 159..344
/gene="LOC111122539"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(177..185,192..194)
/gene="LOC111122539"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 399..587
/gene="LOC111122539"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(414..422,429..431)
/gene="LOC111122539"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 633..815
/gene="LOC111122539"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(642..650,657..659)
/gene="LOC111122539"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 906..1097
/gene="LOC111122539"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(924..932,939..941)
/gene="LOC111122539"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1146..1328
/gene="LOC111122539"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1155..1163,1170..1172)
/gene="LOC111122539"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1491..1679
/gene="LOC111122539"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1506..1514,1521..1523)
/gene="LOC111122539"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1716..1907
/gene="LOC111122539"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1734..1742,1749..1751)
/gene="LOC111122539"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1980..4196
/gene="LOC111122539"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(3027..3029,3033..3035,4128..4130)
/gene="LOC111122539"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(3159..3167,3369..3371,3579..3587,3675..3677,
3795..3803,3861..3863,3870..3872,3879..3881,3936..3938,
3945..3947)
/gene="LOC111122539"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
ORIGIN
tctgtatgtctcaagtctacacaccatttgaagtaatgtttttcaaatcaaagattttatattaggtaaatagtttttcattttattacaaacatacatgtaccttaaggaaggcaacaatgttgggagaagaaacacaggagatggaaaaggtaacagacctccatattgagggcatgacctgccagtcgtgtattgataaaatccaagaccacatggctcgggaaccaggggttattcatgtacagatgtttctggaggaaaaagaggcaaagattacttacagtcccactgagacatcccctcccatactggctgaacaaatctcagacatggggttcccttcaaaggtcaagctagtgcatccagtgaggggagacaactgtcaggatgccatcatcaatgtagggggcatgacatgtcagtcttgtgtcaagtccatagagtccaaaatgttggaggtcagtgggatactgggaataacagtgtccctgttgaagaaacaggcctatgtccagttcaacccgggcaaaatatctgctgagagtattgcttcagccatagatgacatgggttttgaggcctcagtacattccatcacacgtgataagggtctgaccaccaagataggggtggagggcatgacatgccagtcttgtgtcaactccatcgaatctgccatgagaggcaagccaggagtaagagaaataaaggtgtctcttagtgataaagaggcccacatagtgtatgatcccaccctcaccagtccgggatcactccgggatcagattgatgatatgggatttgaagcaacactggcaagagagtcctctattgagagtgaatttgaccgcttggcgtcacgacagtcatccaccagatcagtgcaaagtgaattagtctgccaaatagctgtgaaagggatgacctgtcaatcttgtgtgaagaatattgaaagcaacatttcacccaaacccggagtaatgtctatatctgtgtcattggaaaaagaaatggccagtgtgacttacaaccccctggttaccaatcccacctccatagctgggatgatcgatgacatgggatttgaggcctcggtagagggttcggacgcagagccgtccactgatacggtggttgtgggagtagaaggcatgacctgccattcctgtgtaaaaagcatcgaggaacacatctccaagaacccggctgtcaagtccatcaaggtctctctggcagatcagaatgccaacattgagtattatcccaatagggccactccatccactttgagagatgccatagatgacatgggctttactgcatctctaccaacagatgatgtagcagtgaaggttgtacagcccaaaaagagcagtgggatcaaaccaaagtctccttcagagagtttgaagattgagctagataaaggagctgtgtctttcaggaagggaggggacattgttgatgatgacctagagaagtgctttctgagagtcacagggatgacctgtgcttcctgtgtggccaccatagagaaaaatctaatgaaagtagagggtatacacagttgtttggtagccctgatggcacagaaagcagaggtgaaatatgacccagcctatttattgccatcccagattgcggctaaaatttccagcttggggtttgaagccaccgttttggagagtgaaggatttggccagggagttgtggaacttttgataacagggatgacatgttcttcatgtgtgcacatgattgaatcctccatcatgaagaagnccggggtgatccaggcctcagtggccctatccacctgtaaaggcaagttcacctataacccggaagtcacaggtccaagggcaatcattgaggccatcaagtctttgggataccaagctgagttgtacactgatgatgataaagatgctgctcgttatgaccatagagacgaaatcaaaaggtggagaacctcctttctgtggtctctgatctttggagttccatctgtggtgatcatgatgtacttcatgtttactcctccccctgaggagcacaattctgtcactaatactaccgcagggaattacaccaccacccacaaaccccagacgtcatctgaaggtcactaccagatcatgatagtagccggtctctcactggacaaccttcttatgtttattttggccacaccggtacagtttattggtggacgatacttctacatacaagctttcaaggcgctccgacacggagcagcaaacatggacgtcctggttgttcttgccaccactatctcctacgtgtactcctgtgtggtggtcatcgtggccatgatcatgaaggagaaaactagccccgtgactttctttgaaacaactcccatgttgatggtgtttatatcccttggtagatggctggaacatgtagcaaagggtaaaacatcagaagctcttgccaagctgatgtctctgcaggcttcagaggctgtgctggtggagattgataaagaattcaatattctgaatgaacaaacaattaatgtggatttagtgcagagaggggatgtacttaaggttgttcctggtgaaaagattcctgtggatgccaagatcattgagggaaccaccacttgtgatgagtcccttattacaggggagtctatgcctgtctctaagaagccaggttcctctgtgattggtggttccatcaatcagcatggcatgattctagtgcaggctacacatgtggggtctgacaccaccctgtcccagattgtcaagctcgtggaagaggctcagacctcaaaggcgcctatacagcagcttgctgacaagatagctgggtatttcgtacctggggtggtcattctgtccactcttactgtcattgcttgggccatagtgggctatgttgatgtcaccaaagtcatgccagacttcgtgaatgatgggaccatttccagagatgaggtcatcttccagaaggctttccagtatgccatcacagttctaagtattgcctgtccttgtgccctggggctggccacacccacagctgtcatggtgggaactggtgtaggggccacaaatgggatactgatcaaggggggtgaacccctggaatgttctcacaaattgaagtgtatagtgtttgataagactgggacggttacccatggggttcctcgtgtcgcccgtgtggccatgtttgtggagaactcaatctgctcatttgtcaaactaatagccattgctggaactgctgaaaatagcagtgaacatcccctggcttcagccatcgtcaagtatgcaaaacagactctgaagacggagaccttgggtaagacccagaactaccaggcagtgccaggctgcggtctcaagtgtaccgtgacccagatcgacgggatactggtggacattgacatggagggagtgaacaacaggaagaacctgatgggcagcaccagagtcaagaccgacaatgtcctgtacgacggggaggagattagcgctacaattgaggagagtagtttggttggtgcagtggcctccaggccctacgacgtactgattggaaaccgtgaatggatgacaaggaatggattgattgtgacagataaaatggacgaaacaatgactgagcacgaacatcagggacaaacagccattctgtgtgctattgatggtaaaattatagcgatgttggctgtggccgacactgtgaagtccgaggctcacctagccatcagtgtccttaaagacatggggctacaggtggttctactgaccggagacaaccagaaaactgccagagccattgctagacagattggaatccacaaagtctttgctgaagttctaccctctcacaaagtaaagaagataaaacagcttcagaagcagggtatgaaggtggcaatggtaggggatggggtgaatgactcgcctgccctggcccaggcagatgtgggcatcgccataggaaccgggaccgatgtagctgtggaggcggctgatgtggtcctcatcaagaatgatcttctagatgtggcagcagccattcagctctccaagaaaactgtccggagaatacgcatcaactttttcgctgcttccatttacaacttgattggcatcccaatcgcagctgggatctttgtgccgtggggactgtccctcaagccctggatggcgtcagcagctatggccatgtcctcagtatctgtggtcttttcctccttactcctcaaaacgtttaagaagcccaacaaggaaaagatgctgactcctaaatattatgcaaagtttgctgcggaccaggagctggacaatatttctgttcatcgaggcgtggagagtttgccatccagccgtgaaggaagtaagcaaggaagcatcatttcacgcttgagtggtcggaagaagccaaccacgccagatcacacaagtctgctggagatgggagagaactctgactccgactccagtgatcagctgggataggcatcaactggctgctttagtttgtgaatcatgaacttgtataaacttgtttcaggtagataccactgtcatcataatattgtaaccagacactaaatcacagtcgccaagattaggaaaaagtcggtcatatttatagctcagtggtccaatacatttagtttcaaatcaggcatttgagccccaagtttttaaaaatatgatacaacattatgctaaattatgttcagtacattggtacatgtattacaaaaaatcaagtcacagaactgtgatacattaacatttgattcagagctcatttctccttccccttttaaaaatgtttcacgcgttagatatttggtttttatattgatttgaagctttcacaagaattagttttgcatcatggtagaatatttatctagttttcacaactctagtatatatatcacttatgacaaacttaatataatcatgtaatcattgtcatgttttttgcttttaaggattttgcttggtaacacttacaggagtatttttactactcagttgtgtacttaagagtcccaaccatttaccagtttttgaccactgatgatgtgtcccatttgttgtccatcctttacatacacacctaccactgcagtccctcaaatacatctgtaatacagtccgtcagaatgaaaagttcaaacaacacaattgatttgttgttcagaatagaacaggccaataatctggataaagcagagctttgacagacagtttcatctgtctcctactgaatttgttatgacttgtaactgttgcttatacatgtgtgttatgaataaatatcatatattatagaggag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]