GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 06:06:53, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_021383796            2454 bp    mRNA    linear   VRT 07-JUN-2017
DEFINITION  PREDICTED: Numida meleagris zinc finger protein 252-like
            (LOC110391848), partial mRNA.
ACCESSION   XM_021383796
VERSION     XM_021383796.1
DBLINK      BioProject: PRJNA383663
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Numida meleagris (helmeted guineafowl)
  ORGANISM  Numida meleagris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Numididae; Numida.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018364764.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Numida meleagris Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 20% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..2454
                     /organism="Numida meleagris"
                     /mol_type="mRNA"
                     /isolate="19003"
                     /db_xref="taxon:8996"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="Blood"
                     /breed="g44 Domestic line"
     gene            1..>2454
                     /gene="LOC110391848"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 67% coverage of the
                     annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:110391848"
     CDS             1..>2454
                     /gene="LOC110391848"
                     /codon_start=1
                     /product="zinc finger protein 252-like"
                     /protein_id="XP_021239471.1"
                     /db_xref="GeneID:110391848"
                     /translation="
MHSESSLRQRRSLRSGFPAPRPARGWALLRSLLLLALCRPVLRPPRPPHRHNPNVSFIFVRFTAWHYVGCDRLWAGLVSALCRAVRLRFGPWPLAVFHVAGVPPRFGPGRRDWEPRAGACLKLGALGLLLAAGLGLLAAAAAAPWLREHRALNAAGAALSSASGSGLLAAVVAVLRRAAIGERRRLERLAAGESFAEQLGFMSKVRAELEELARFLAAMEVCEGRRLRVVLQISALERCGAERCAGVLEALNTLLADPRAPFVSVLAADPGVVVPCLESSGALHGVGGNAYVYLRRTVSLPFSLPRMDTADRIGALRARLGERDGAGERELQRNQRAGQRGERARNGNQRAGHGNQRAGEHPLSYNEHPSLHGEHPSPSNEHPLSCNEHPSLHGEHPLSCKEHPSPYNHHPLHHHEHPLHLGEHPSPSSEHPSPHGEHPLYTGEHPSPCNEHPLPHGEHPHHGGHPSPHSHHPVHCSEHPLHLGEHPSPCSEHPLSYNEHPSTHGEHPAQHEEHPVHHGEHPPHGEHPLSCNEHPLPHGEHPSPSNEHPLSCSEHPSPYNHHPLHHHEHPLHLGEHPAPSSEHPLHHGEHPSPCNEHPLHHGGHPSPCKEHPSPYNHHPLHCSEHPLHLGEHPAPSSEHPLHHGGHPSSCNEHPLHHGEHPVPSNEHPSPYNHHPSHCSEHPLHHGEHPAPLGEHPPHGEHPLSCSEHPSPYNHHPLHHHEHPLHLGEHPSPSSEHPSPHGEHPSHGEHPSPHGERPWVRFGAARARRFVRAALRSLHDPAEPLSRYVPADGAQLRRLLNTVPITVRLLLHRCAAGGQ"
     misc_feature    <598..954
                     /gene="LOC110391848"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl38936"
                     /db_xref="CDD:453896"
     misc_feature    <1342..>2130
                     /gene="LOC110391848"
                     /note="Atrophin-1 family; Region: Atrophin-1; pfam03154"
                     /db_xref="CDD:427171"
ORIGIN      
atgcactccgagtcctccctccggcagcgccgttctctccgctccggtttccccgctccccgtcccgcccgtggctgggctctgctccgctccctgcttctccttgctctgtgccgcccggtcctgcgtcccccccgccccccgcaccgccacaaccccaacgtctccttcatcttcgtgcgcttcacggcttggcattacgtgggctgcgatcgcctttgggccgggctggtcagcgccctgtgccgagccgtccgcctccgcttcggcccgtggcccttggccgtgttccacgtggccggggtccccccccgcttcggtccgggccgtcgggattgggagccccgagcgggcgcctgcctgaagctgggagcgctggggctgctcctggccgcggggctggggctgctggcggcggccgcggccgctccgtggctccgcgaacaccgggcgctgaacgcggccggggcggctctgagctccgcgtccggttcggggctcctggccgcggtcgtggccgtgctccgccgggcggcgatcggagaacggcgccgtttggagcggctggcggccggggagagcttcgcggagcagctgggtttcatgagcaaagtgcgggcggagctggaggagctggcccggttcctggcggccatggaggtgtgcgaggggaggcggctccgcgtggtgctgcagatctcggcgctggaacgttgcggggccgagcgctgcgcgggggtcctggaagcgctgaacacgctgctggccgatccccgagccccgttcgtctccgtgctggccgccgatcccggcgtcgtcgtgccgtgcctcgagagctccggagcgttgcacggggtgggaggcaacgcttacgtgtacctgcggcggaccgtcagcctgcccttctccctgccacgcatggacacggcggacaggatcggggcgctgagagcgcggctcggggaacgggacggcgccggggaacgggagctgcaacgcaaccagcgggcagggcagcgcggggagcgggcgaggaacggcaaccagcgggcagggcacggcaaccagcgggcaggcgagcacccattgtcctacaatgagcacccatcgctccatggggagcacccatcacccagcaatgagcacccattgtcctgcaatgagcacccatcgctccatggggagcacccattgtcctgcaaggagcacccatcaccctacaaccatcacccactgcatcaccatgagcacccactgcacctcggggagcacccatcacccagcagtgagcacccatcgccccacggggagcacccattgtacaccggggagcacccatcaccctgcaatgagcacccattgccccacggggagcacccacaccatggggggcacccatcgccccacagccatcacccagtgcactgcagcgagcacccactgcacctcggggagcacccatcgccctgcagtgagcacccattgtcctacaatgagcacccatcaacccacggggagcacccagcacagcacgaggagcacccagtgcaccatggggagcacccaccccacggggagcacccattgtcctgcaatgagcacccactgccccatggggagcacccatcacccagcaatgagcacccattgtcctgcagtgagcacccatcgccctacaaccatcacccattgcaccaccatgagcacccactgcacctcggggagcacccagcgcccagcagtgagcacccattgcaccatggggagcacccatcaccctgcaatgagcacccattgcaccatggggggcacccatcgccctgcaaggagcacccatcgccctacaaccatcacccattgcactgcagtgagcacccactgcacctcggggagcacccagcgcccagcagtgagcacccattgcaccatgggggacacccatcgtcctgcaatgagcacccattgcaccatggggagcacccagtgcccagcaatgagcacccatcgccctacaaccatcacccatcgcactgcagcgagcacccactgcaccatggggagcacccagcgcccctcggggagcacccaccccacggggagcacccattgtcctgcagtgagcacccatcaccctacaaccatcacccactgcatcaccatgagcacccactgcacctcggggagcacccatcgcccagcagtgagcacccatcgccccacggggagcacccatcccacggggagcacccatccccccacggggagcgcccttgggtgcgtttcggggcggcccgtgcccggcgcttcgtgcgggcggcgctgcgctccctgcacgaccccgcggagccgctgtcccgttacgtccccgccgacggcgcccagctccgccgcctgctcaacaccgtccccatcaccgtgcgactcctgctgcaccgctgcgccgccggggggcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]