LOCUS       XM_018626970             779 bp    mRNA    linear   PLN 08-JUN-2023
DEFINITION  PREDICTED: Raphanus sativus uncharacterized LOC108853560
            (LOC108853560), mRNA.
ACCESSION   XM_018626970
VERSION     XM_018626970.2
DBLINK      BioProject: PRJNA344915
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Raphanus sativus (radish)
  ORGANISM  Raphanus sativus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Brassiceae; Raphanus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_079514) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 8, 2023 this sequence version replaced XM_018626970.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000801105.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/01/2023
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 42% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..779
                     /organism="Raphanus sativus"
                     /mol_type="mRNA"
                     /cultivar="WK10039"
                     /db_xref="taxon:3726"
                     /chromosome="4"
                     /tissue_type="leaf"
     gene            1..779
                     /gene="LOC108853560"
                     /note="uncharacterized LOC108853560; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1
                     Protein"
                     /db_xref="GeneID:108853560"
     CDS             1..633
                     /gene="LOC108853560"
                     /codon_start=1
                     /product="uncharacterized protein LOC108853560"
                     /protein_id="XP_018482472.2"
                     /db_xref="GeneID:108853560"
                     /translation="

MDDGEYALIFYMPELRYRLQGSDCYDQGFSRLAKLCHGAGEDRNVTDLLPGFQDSYVPRARNQISDFLSKTARSFHRELLFIATNKKKINDTPSSSLQPINNTPILLSHYHIKEQFLSFIHSISLYKMDSRTLVLVLLVCLIFLHDASDITHANANFHALPIRKMMVMEKENEWGGANGNEELRTVPSGPDPLHHHVNPPRQPRTDSHLP"

ORIGIN      

atggacgatggagaatatgctttaatattctacatgccagagcttcggtacagactgcaaggatctgattgctatgatcaaggattctcacgcttggccaaactttgccacggagctggagaagatagaaacgttactgatctgcttcccggatttcaagattcttatgttcctcgagcgcgcaatcagatttcagattttttatctaaaacagctagatccttccacagggagttacttttcattgcaaccaataaaaaaaaaataaacgataccccttcctcctccttgcagcctataaataatacccccattctcttatctcattaccacatcaaagaacaatttctatcgtttattcactctatctctctctacaaaatggattcgaggactctggtgctagtgctgctcgtttgcctcatcttcctgcatgatgcttctgatatcactcacgccaatgccaattttcatgcacttcccattcgcaagatgatggtgatggagaaggagaatgaatggggaggagcaaatggaaatgaagagttaaggactgttccttcaggacctgaccctttgcatcatcatgtgaaccccccaagacagccacggaccgactctcatctcccttaaaacgtcctttcttttgtttctttaatgtagttcgtattgtaaattaactcttctgtttaatcagttttatgttgggagattttcagtttaatctctcactttccctaaggttgtgatgatggttaatgtaagataagcacaacttt

//