LOCUS       XM_018575345            2755 bp    mRNA    linear   VRT 30-SEP-2016
DEFINITION  PREDICTED: Nanorana parkeri copper-transporting ATPase 1-like
            (LOC108803509), partial mRNA.
ACCESSION   XM_018575345
VERSION     XM_018575345.1
DBLINK      BioProject: PRJNA344660
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Nanorana parkeri
  ORGANISM  Nanorana parkeri
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Neobatrachia; Ranoidea; Dicroglossidae;
            Dicroglossinae; Nanorana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017310083.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Nanorana parkeri Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 12% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..2755
                     /organism="Nanorana parkeri"
                     /mol_type="mRNA"
                     /isolate="BGI_ZX_2015"
                     /isolation_source="muscle sample"
                     /db_xref="taxon:125878"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="China"
                     /collection_date="Aug-2012"
     gene            1..>2755
                     /gene="LOC108803509"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 Proteins, and 72% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:108803509"
     CDS             1..>2755
                     /gene="LOC108803509"
                     /codon_start=1
                     /product="copper-transporting ATPase 1-like"
                     /protein_id="XP_018430847.1"
                     /db_xref="GeneID:108803509"
                     /translation="

MPGGVAAVWQHAGWSCRGLAACRVELQRSGSMPCGVAEVSLEDGNAAVIYDPAFWGPVTLQEAIEDMGFVSAPVSLHPQAVPTDSLVFHLSQDQAGERTCPDLLALKGVLDVTGEGSVLRVTFIPSLVSADTMIQRFPALSLDAPNPSQESAPDVVLLKMKVEGMTCHSCVSTIEGKIGKLQGVQRIKVSLDNQEAHILFQPHLITPDEIRSQIQKAGFSASLKSKPLAKLGKIDVGRLTTAQVNGNGDVSQPRPKPHTDLTRAVFQVEGMHCKSCVVNIEGGMASHAGVTGVEVSLEKRSAVITYHPNLTNSDALCRAMEALSPGTFRVTLDSVPRTTGTASQTPSKRTNPESPPQITVITIQGMTCNSCVQSIEGLISQKPGVRSIRVSLGDGTGTVEYDPAVTSPETLRDAIQDMGFDASLAEGMTSVTSLDPPRKPPHPSSQEMPVKSKQESSTSNKCFIRVSGMTCASCVANIERNLRKEDEGMTSVTSLDPPRKPPHPSSQEMPVKSKQESSTSNKCFIRVSGMTCASCVANIERNLRKEDGIHSVLVALMAGKAEVRYNPVLIQPAAIAELIQELGFEASVIENCDEGDGVLELVVRGMTCASCVHKIESCLMKTKGVLYGSVALATNKAHMKYDPEMIGPRDLMKIIDDLGFKTSLVKRDRSASHLDHRGEIQRWKQSFLISLIFCIPVMGLMIYMMFMDSDHMMPHHHNMTMDDITTYHPTMVLEYQVMPGLSIMNLLSFLLCIPVQFLGGWYFYIQAYKALKHRTANMDVLIVLATSIAFIYSLVILLVAVCEKAKVNPVTFFDTPPMLFVFIALGRWLEHLAKSKTSEALSRLISLQATEATIVTLGPDNSVLSEVPVDVELVQRGDIVKVTPGGKFPVDGRVIEGHSMVDESLITGKDTDIEGECR"

     misc_feature    <103..207
                     /gene="LOC108803509"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    475..666
                     /gene="LOC108803509"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(493..501,508..510)
                     /gene="LOC108803509"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    793..969
                     /gene="LOC108803509"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(811..819,826..828)
                     /gene="LOC108803509"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1078..1269
                     /gene="LOC108803509"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1096..1104,1111..1113)
                     /gene="LOC108803509"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1573..1761
                     /gene="LOC108803509"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1588..1596,1603..1605)
                     /gene="LOC108803509"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1798..1989
                     /gene="LOC108803509"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1816..1824,1831..1833)
                     /gene="LOC108803509"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2053..>2724
                     /gene="LOC108803509"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:451251"
ORIGIN      

atgccgggtggagttgcagcggtctggcagcatgccgggtggagttgcagaggtctggcagcatgccgggtggagttgcagaggtctggcagcatgccgtgtggagttgcagaggtgtcgttggaagacgggaacgctgctgttatttatgatcccgccttctgggggccggtcactctccaggaagccattgaggacatgggatttgtgtcggctccggttagtttacatccacaagctgtacctacagacagtctcgtatttcacctctcccaggatcaggctggggagcggacctgcccggatctgctggcactgaagggggttctggatgtgacgggggaggggagcgtgctccgtgtgacttttataccgtcacttgtcagtgctgacaccatgattcagaggttcccggccctgagcctagacgccccgaaccccagccaagaatctgctccggacgttgtcctgctgaagatgaaggtggagggcatgacctgccattcctgcgtcagtaccatcgaaggcaaaatcgggaagctgcaaggcgtgcaacgcatcaaagtgtccctggataaccaggaagctcacatcctcttccagccgcacctcatcacgccggacgagatccggagccaaatccaaaaagccgggttttcggcatcgctgaagagcaagccgctcgccaagctggggaagatcgacgtcggccgactgaccactgcacaggtgaatggtaacggggacgtgtcccagccaagaccaaagccgcatactgacctaaccagagccgtcttccaagtagaaggcatgcactgcaaatcatgtgttgtgaacattgaaggcggcatggcgtctcatgccggggtgaccggggtggaagtgtcgttagagaaacgatccgcagtgatcacttatcatccaaatctcaccaattccgatgcactgtgcagagcgatggaagcgttgtctccggggaccttcagagtgactctggactctgtccccagaaccaccggaaccgcctcccaaaccccttccaagaggaccaatcccgagagtccaccccagatcaccgtcattaccattcaagggatgacctgcaattcatgtgtccagtccattgagggtctgatctcacagaagccgggtgtcaggtctattcgggtgtcactgggagatgggacggggactgtggagtatgacccggccgtcaccagtccggagaccctccgagacgctattcaggacatgggatttgatgcctctctagctgaaggaatgacatctgtcacctcattggatcccccccggaaacctccgcacccttcttcccaagaaatgcctgtgaagagcaagcaggagagcagcacaagcaacaagtgtttcattcgggtctccggcatgacgtgcgcttcctgtgtcgccaacatagagagaaatcttcgcaaggaggacgaaggaatgacatctgtcacctcattggatcccccccggaaacctccgcacccttcttcccaagaaatgcctgtgaagagcaagcaggagagcagcacaagcaacaagtgtttcattcgggtctccggcatgacgtgcgcttcctgtgtcgccaacatagagagaaatcttcgcaaggaggacggtatacattccgtcctggtggctctgatggcggggaaggccgaggtccggtacaacccggtgctcatacagccggcggccattgctgagctcattcaggagctgggattcgaggcctctgtgattgagaactgtgatgaaggagatggagtgctggaactggtggttcgggggatgacgtgcgcctcctgtgtacataagatcgagtcttgtctgatgaaaaccaaaggagttctgtacggttctgttgctctcgccaccaataaagctcacatgaaatatgacccggagatgattggaccgagagatctcatgaagattattgatgatttaggatttaaaacgtcgttggttaaaagagatcgatctgccagccacctggatcacaggggggagatacagaggtggaaacaatcgtttctgatcagtttaatattttgtatccctgtcatgggattaatgatctacatgatgttcatggacagtgatcacatgatgcctcaccaccacaacatgaccatggatgacataactacctaccatccgaccatggtgctggagtaccaggtcatgccaggactctccatcatgaacctcctgtcctttctgctgtgtatacctgtacagtttttaggaggctggtacttctacatacaagcatacaaggctctgaaacatagaacagccaacatggacgtgctgattgtcctggccacctccatcgccttcatctattccctggtgatccttctggtggccgtgtgtgagaaagccaaagtcaaccccgtcaccttcttcgacacgccgcccatgctcttcgtcttcatcgctctgggacggtggctggaacacctagccaagagcaaaacgtcggaagctttgtcccgtctgatctccctgcaggccacagaggccacaattgtcacgttgggccccgacaactctgtcctcagtgaggttccggtggacgtggagctggttcagcgcggagacattgtgaaggtgacacccggaggcaagttccctgtggacggacgcgtgattgaaggccactccatggtggatgaatctctcatcactggtaaagataccgacatagagggggagtgccggg

//