LOCUS       XM_017877137            1287 bp    mRNA    linear   PRI 24-AUG-2016
DEFINITION  PREDICTED: Rhinopithecus bieti copper-transporting ATPase 1
            (LOC108532863), partial mRNA.
ACCESSION   XM_017877137
VERSION     XM_017877137.1
DBLINK      BioProject: PRJNA339282
KEYWORDS    RefSeq.
SOURCE      Rhinopithecus bieti (black snub-nosed monkey)
  ORGANISM  Rhinopithecus bieti
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Colobinae; Rhinopithecus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_016806636.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Rhinopithecus bieti Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..1287
                     /organism="Rhinopithecus bieti"
                     /mol_type="mRNA"
                     /isolate="Rb0"
                     /db_xref="taxon:61621"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
     gene            1..>1287
                     /gene="LOC108532863"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 EST, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     6 samples with support for all annotated introns"
                     /db_xref="GeneID:108532863"
     CDS             42..>1287
                     /gene="LOC108532863"
                     /codon_start=1
                     /product="copper-transporting ATPase 1"
                     /protein_id="XP_017732626.1"
                     /db_xref="GeneID:108532863"
                     /translation="

MPLLTSTNEFYTKGMTPVQDKEEAKTSSKCYIQVTGMTCASCVANIERNLRREEGIYSILVALMAGKAEVRYNPTVIQPPMIAEFIRELGFGATVIENADEGDGVLELVVRGMTCASCVHKIESSLTNHRGILYCSVALATNKAHIKYDPEIIGPRDIIHTIESLGFEASLVKKDRSASHLDHKREIRQWRRSFVVSLFFCIPVMGLMIYMMVMDHHFATLHHSQNMSKEEMINLHSSMFLERQILPGLSIMNLLSFLLCVPVQFFGGWYFYIQAYKALKHKTANMDVLIVLATTIAFAYSLVILLVAMYERAKVNPITFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLISLQATEATIVTLDSDNILLSEEQVDVELVQRGDIIKVVPGGKFPVDGHVIEGHSMVDESLIT"

     misc_feature    135..323
                     /gene="LOC108532863"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(150..158,165..167)
                     /gene="LOC108532863"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    360..551
                     /gene="LOC108532863"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(378..386,393..395)
                     /gene="LOC108532863"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    615..>1287
                     /gene="LOC108532863"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:451251"
ORIGIN      

cgaatgagcccttggtagtaatagctcagccttcatcggaaatgccacttttgacttcaactaatgaattttatactaaagggatgacaccagttcaagacaaggaggaagcaaagacttcatctaagtgttacatacaggtcactggcatgacttgtgcttcctgtgtagcaaacattgaacggaatttaagacgggaagaaggaatatattctatacttgtggccctgatggctggcaaggcagaagtaagatataatcctactgttatacaacccccaatgatagcagagttcatccgagagcttggatttggagccactgtgatagaaaatgctgatgaaggagatggtgttttggaacttgttgtgagaggaatgacgtgtgcctcctgtgtacataaaatagagtcgagtctcacaaatcacagagggatcctgtactgctctgtggccttggcaaccaacaaagcacatattaaatatgacccagaaattattggtcccagagatattatccatacaattgaaagcttaggttttgaagcttctttggtcaagaaggatcggtcagcaagtcacctagatcataaacgagaaataagacaatggagacggtcttttgttgtgagtctgtttttttgtattcctgtaatggggctgatgatatatatgatggttatggaccaccactttgcaactcttcaccatagtcaaaacatgagtaaagaagaaatgatcaaccttcattcttctatgttcctggagcgccagattcttccaggattgtccattatgaatttgctgtcctttttattgtgtgtacctgtacagtttttcggaggctggtacttctacattcaggcttataaagcactgaagcataagacagcaaatatggacgtactgattgtgctggcaaccaccattgcatttgcctactctttggttattcttctagttgcaatgtatgaaagagccaaagtgaaccctattactttctttgacacaccccctatgctgtttgtgtttattgcactaggccgatggctggagcatatagcaaagggcaaaacatcagaggctcttgcaaagctaatttcactacaagctacagaagcaactattgtaactcttgattctgataatatcctcctcagtgaagaacaagtggatgtggaacttgtacaacgtggagatatcattaaagtagttccaggaggcaaatttccagtggatggtcatgttattgaaggacattctatggtagatgagtccctcatcacag

//