2024-05-18 12:51:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_016267859 1969 bp mRNA linear VRT 19-APR-2016 DEFINITION PREDICTED: Sinocyclocheilus grahami uncharacterized LOC107582125 (LOC107582125), mRNA. ACCESSION XM_016267859 VERSION XM_016267859.1 DBLINK BioProject: PRJNA316320 KEYWORDS RefSeq; includes ab initio. SOURCE Sinocyclocheilus grahami ORGANISM Sinocyclocheilus grahami Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Sinocyclocheilus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015505219.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Sinocyclocheilus grahami Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 6% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1969 /organism="Sinocyclocheilus grahami" /mol_type="mRNA" /isolate="Dianchi" /db_xref="taxon:75366" /chromosome="Unknown" /sex="female" /tissue_type="muscle" /dev_stage="adult" /country="China: Lake Dianchi, Yunnan" /collection_date="2012-08-15" /note="surface-dwelling" gene 1..1969 /gene="LOC107582125" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins, and 92% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:107582125" CDS 11..1969 /gene="LOC107582125" /codon_start=1 /product="uncharacterized protein LOC107582125" /protein_id="XP_016123345.1" /db_xref="GeneID:107582125" /translation="
MMRSFQSPYFQLLCLLIAALLECKERPCKQVLQLNISHLHGDCMSISCQSTTHLLDSLTVKLSSINPVKDILMYPDISPASEHQRWSVRKDDGNFTLDLKDIRLSDGGLYDCQVYKDQDCLHSTQFYLSIIQCKILNSVHATLNSQVLLPCSEHPLQNRTEPVTWKVINGHQLTDITQYRAPNKPSSGTEKPPNPLFERARLLKNGSLLIRKAVDTDELWYHCRVNEKTCYEMRLVMKVQLSCCEHLYMMRSFQSPYFQLLCLLIAALLECKERPCKQVLQLNISHLHGDCMSISCQSTTHLLDSLTVKLSSINPVKDILMYPDISPASEHQRWSVRKDDGNFTLDLKDIRLSDGGLYDCQVYKDQDCLHSTQFYLSIIQCKILNSVHATLNSQVLLPCSEHPLQNRTEPVTWKVINGHQLTDITQYRAPNKPSSGTEKPPNPLFERARLLKNGSLLIRKAVDTDELWYHCRVNEKTCYEMRLVMKAHNTSRSTKVLETLSTTLVTTASADSLAGLAENNSDGSETVTTNLTVVVMMTTVVSLCVLISLTICVILYFKKQRRKTNSQTQLNSRISVYYSHVAEGFDVPLYSLVEQNTGSMITFGAAQSEAPACKADNIETCEEEEEEEEEGSVWQNRSARGESCTEAIHYSA"
misc_feature 113..361 /gene="LOC107582125" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 140..154 /gene="LOC107582125" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 185..205 /gene="LOC107582125" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 293..307 /gene="LOC107582125" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 335..352 /gene="LOC107582125" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature <575..685 /gene="LOC107582125" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 626..640 /gene="LOC107582125" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 668..685 /gene="LOC107582125" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 857..1105 /gene="LOC107582125" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 884..898 /gene="LOC107582125" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 929..949 /gene="LOC107582125" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1037..1051 /gene="LOC107582125" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1079..1096 /gene="LOC107582125" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature <1319..1429 /gene="LOC107582125" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1370..1384 /gene="LOC107582125" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1412..1429 /gene="LOC107582125" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" ORIGIN
gcatctgtatatgatgaggagttttcagtctccatatttccaactcctgtgtcttctaatagcagcgttattagaatgcaaagagagaccctgcaagcaggttcttcagttgaacataagccatttacatggtgactgtatgtctatttcttgccaatcaacaacccacctgctggattctctaacagtcaaactaagcagtatcaacccggttaaagacatactgatgtatccagatatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaattttacacttgatctgaaagacatcagattatccgatggtggcctttatgactgtcaggtctacaaggatcaggactgccttcattcaacacaattttacctgagtattatacagtgtaaaattttgaactctgtccatgcaacgttaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaaccagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcggcacagagaaacccccgaaccccctgtttgagagagcgagactactgaagaacggatctttgcttataagaaaagcagtcgacactgatgaattgtggtatcattgcagagtgaatgaaaaaacctgctatgagatgaggctggtgatgaaagttcagctgtcctgctgtgagcatctgtatatgatgaggagttttcagtctccatatttccaactcctgtgtcttctaatagcagcgttattagaatgcaaagagagaccctgcaagcaggttcttcagttgaacataagccatttacatggtgactgtatgtctatttcttgccaatcaacaacccacctgctggattctctaacagtcaaactaagcagtatcaacccggttaaagacatactgatgtatccagatatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaattttacacttgatctgaaagacatcagattatccgatggtggcctttatgactgtcaggtctacaaggatcaggactgccttcattcaacacaattttacctgagtattatacagtgtaaaattttgaactctgtccatgcaacgttaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaaccagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcggcacagagaaacccccgaaccccctgtttgagagagcgagactactgaagaacggatctttgcttataagaaaagcagtcgacactgatgaattgtggtatcattgcagagtgaatgaaaaaacctgctatgagatgaggctggtgatgaaagctcataatacatctcgttccacaaaggtattagaaacactttccacaacattggtaaccacagcctctgctgacagtcttgctggcctggctgaaaataacagtgatgggagtgaaacagtgacaactaatctgacagtagtagtgatgatgaccacagtagtgtctctgtgtgtcctcatatcactgaccatctgtgtcattctttatttcaaaaaacaaaggcgcaaaaccaacagccaaacacagttaaacagtcggatctctgtgtattactcccatgttgcagaagggtttgatgtcccattgtattctttagttgaacaaaacacaggatcaatgatcacctttggtgctgcacaatcagaagctccggcatgtaaagcagataacattgaaacctgcgaggaggaggaggaggaggaggaggaggggagtgtctggcagaaccgttcagctcgcggtgagagctgcaccgaggctattcattattcagcgtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]