2024-05-19 12:31:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_014787914 3463 bp mRNA linear MAM 27-NOV-2015 DEFINITION PREDICTED: Ceratotherium simum simum nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (LOC101397259), mRNA. ACCESSION XM_014787914 VERSION XM_014787914.1 DBLINK BioProject: PRJNA191537 KEYWORDS RefSeq. SOURCE Ceratotherium simum simum (southern white rhinoceros) ORGANISM Ceratotherium simum simum Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Perissodactyla; Rhinocerotidae; Ceratotherium. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_004454188.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Ceratotherium simum simum Annotation Release 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3463 /organism="Ceratotherium simum simum" /mol_type="mRNA" /isolate="SDZICR_KB13650" /sub_species="simum" /db_xref="taxon:73337" /chromosome="Unknown" /sex="female" /country="USA: San Diego Zoo, California" gene 1..3463 /gene="LOC101397259" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 mRNAs, 4 Proteins, and 97% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:101397259" CDS 72..2987 /gene="LOC101397259" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit" /protein_id="XP_014643400.1" /db_xref="GeneID:101397259" /translation="
MAEDDPYLGGHEQMFHLDSLNHTIFNPELFQQEMPLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGAGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGMKHGTIDAPCKNDPESCDESDDRETVNVFGKVTETTAQDKESRDEDDEVTLTHAAGVKKENSKFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKILNILLKHKKAALLIDHPNAEGLNAIHVAMMSNSMPCLLLLVAAGADVNAQERKSGRTALHLAAEHDNISLAGCLLLEGEAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWEEDGEDEGVVPGTTPLDMATNWQVFDILNGKPYEPELTSDGLLAQGDMKQLNEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQTAFCSSGTAAPSPGKTTCQVPSLPLSPASTRQQIDELREDSVCDSGVETSFRRLSFTESLASGSSLLTLNKVPHDYGQEGPIEGKI"
misc_feature 192..797 /gene="LOC101397259" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(234..236,240..245,249..254,261..272,495..497, 501..506,795..797) /gene="LOC101397259" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 816..1121 /gene="LOC101397259" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(819..821,825..833,837..845,963..971,1008..1010, 1044..1046,1101..1103,1110..1112,1116..1118) /gene="LOC101397259" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(825..830,834..836,873..875,879..881,885..887, 984..989,996..998,1002..1004) /gene="LOC101397259" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(888..890,894..896,987..992) /gene="LOC101397259" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature order(1683..1685,1689..1691,1701..1706,1713..1721, 1725..1730,1740..1742,1749..1751,1794..1796,1800..1802, 1806..1808,1818..1823,1830..1838,1842..1847,1857..1859, 1866..1868,1893..1895,1899..1901,1905..1907,1917..1922, 1929..1937,1941..1946,1956..1958,1965..1967) /gene="LOC101397259" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1683..1796 /gene="LOC101397259" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1722..2189 /gene="LOC101397259" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:223738" misc_feature 1800..1895 /gene="LOC101397259" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2109..2198 /gene="LOC101397259" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2505..2726 /gene="LOC101397259" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
gctcaggcccgcgcccctggagggagcccccggcgcagggaggccgcgcggacccgccaccaggctccagaatggcagaagacgatccatatttgggagggcatgaacaaatgtttcatttggattctttgaatcatacaatatttaatccagaattatttcaacaagagatgccactaccgacagatggcccataccttcaaatattagagcaacccaaacagagaggatttcgtttccgttatgtctgtgaaggtccatcccatggtggactccccggtgcgtccagtgaaaagaacaagaagtcctaccctcaggtcaaaatctgcaactatgtgggacctgcaaaggttattgttcagttggtcacgaatggaaaaaacatccacttgcatgcacacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcccgaatgaccgaggcctgtgtaaggggctataatccaggacttttggtgcatcctgatcttgcctacttgcaggcggaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctcttcagcagaccaaggagatggacctcagtgtggtgcggctcatgtttacagcgtttcttccagacagcacgggcagcttcacgcggcgcctggagcccgtggtgtcagacgccatctatgacagcaaagcccccaacgcctccaacttgaagattgtaagaatggacaggacagctggatgcgtaactggaggggaagagatctatcttctctgtgacaaggttcaaaaagatgacatccagatccgattttatgaggaggaagagaatggtggagtctgggaaggatttggagacttttcccccacagacgttcatagacaatttgccatcgtcttcaagactccaaagtataaagatgtcaacattacaaaaccagcctctgtgttcgtccaacttcggaggaaatctgacttggaaactagcgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcctaacttctcggatagtttcggcggcggcagtggtgccggagctggaggtggcggcatgtttggcagtggcggtggaggagggggtgctggaagcacaggtccagggtacggctttccccactacggatttcctacatatggcggaattaccttccaccctggaaccactaaatctaatgctggtatgaagcatggaaccatagatgccccatgtaaaaatgaccctgaaagttgtgacgagagtgatgacagagagactgtaaatgtcttcgggaaagtaaccgaaaccacagcacaagataaggagtccagggatgaggatgatgaggttactctgacgcacgcagcaggagtaaagaaagagaattccaagtttcaggataacctctttctagagaaggctatgcagcttgccaagaggcatgccaatgccctttttgactatgcggtgacaggagacgtgaagatgctgctggctgtccagcgccatcttactgcagtgcaggatgagaatggggacagtgtcttacacttagcaatcatccaccttcatgctcaacttgtgagggacctgctagaagtcacatctggtttggtttctgatgacattatcaacatgagaaatgatctctaccagacaccgttgcacttggcggtgatcaccaagcaggaggctgtggtggaggacttgctgagggccggcgctgacctaagcctcctggaccgcttgggtaactcggttttgcacctagctgccaaagaaggacatgataaaattctcaatattttactcaagcacaaaaaggcagcactacttatcgaccaccccaatgcggaaggtctgaatgccatccacgtagccatgatgagcaacagcatgccgtgtctgctgctgctggtggccgccggggcggacgtcaacgcccaggagcggaagtcggggcgcacggcgctgcacctggctgcagagcacgacaacatctccctggccggctgcctgctcctggagggtgaagcccacgtagacagcaccacctacgatggaactacacccctgcacatcgcggcggggagagggtcgaccaggctggcagctcttctcaaagcagcaggagcagaccccctggtggagaactttgaacctctctatgacctggatgactcttgggaagaggatggagaggatgaaggagtcgtgcctggaaccacacctctagatatggccaccaactggcaggtatttgacatattaaatgggaaaccatatgagcccgagttgacatcagatggtttactggcacagggagacatgaaacagctgaatgaagatgccaagttgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaaattaggtctagggatactaaataatgccttccggctgagtcctgctccttctaagactctcatggacaactacgaggtctctggggggacagtaaaagagctggtggaggccctgagacagatgggctacactgaagccatcgaggtgatccagacagccttctgcagctcaggaactgcagcccccagcccagggaagaccacctgtcaggttccctcgctgcctctctcgcctgcctccacaaggcagcaaatagacgagctccgggaggacagcgtctgtgacagcggcgtggagacctccttccgcagactcagcttcacagagtctctggccagcggcagctcactgctgactcttaacaaagtgccccacgattacgggcaggaaggacctatagaaggcaaaatttagcccactggcgatttccaacaccatgtaaaccaaagctctgaaattccaccacagtgtccaaaagaaggaaggtcgagtgcatcccgaggtgctccgaggaaagctgcccacctggaccgttctggactccactcgaggctttagaaagccggcttccttccctggttcttagacgcgctttagccggggtcacgcacgatagcatctcgcagtccaggccccggctgggcggaggcctcactggggtgaggtggcttcttgaactttaccagctgctttctgttgtcattgctgctgtccctctgctgcgctcccactgtcattacaaggtgtcccagccccacccggggttctttctggccgtccacagcacggttgtgcattcagattaaggattaaagaaagggatattttaaaatgagaagactcacttggtgtataataaaaaaggcctactcctttttctgctgtggtta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]