GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 12:31:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_014787914            3463 bp    mRNA    linear   MAM 27-NOV-2015
DEFINITION  PREDICTED: Ceratotherium simum simum nuclear factor of kappa light
            polypeptide gene enhancer in B-cells 1 (LOC101397259), mRNA.
ACCESSION   XM_014787914
VERSION     XM_014787914.1
DBLINK      BioProject: PRJNA191537
KEYWORDS    RefSeq.
SOURCE      Ceratotherium simum simum (southern white rhinoceros)
  ORGANISM  Ceratotherium simum simum
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Perissodactyla; Rhinocerotidae;
            Ceratotherium.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004454188.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Ceratotherium simum simum Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3463
                     /organism="Ceratotherium simum simum"
                     /mol_type="mRNA"
                     /isolate="SDZICR_KB13650"
                     /sub_species="simum"
                     /db_xref="taxon:73337"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="USA: San Diego Zoo, California"
     gene            1..3463
                     /gene="LOC101397259"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 mRNAs, 4 Proteins, and 97%
                     coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:101397259"
     CDS             72..2987
                     /gene="LOC101397259"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit"
                     /protein_id="XP_014643400.1"
                     /db_xref="GeneID:101397259"
                     /translation="
MAEDDPYLGGHEQMFHLDSLNHTIFNPELFQQEMPLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGAGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGMKHGTIDAPCKNDPESCDESDDRETVNVFGKVTETTAQDKESRDEDDEVTLTHAAGVKKENSKFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKILNILLKHKKAALLIDHPNAEGLNAIHVAMMSNSMPCLLLLVAAGADVNAQERKSGRTALHLAAEHDNISLAGCLLLEGEAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWEEDGEDEGVVPGTTPLDMATNWQVFDILNGKPYEPELTSDGLLAQGDMKQLNEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQTAFCSSGTAAPSPGKTTCQVPSLPLSPASTRQQIDELREDSVCDSGVETSFRRLSFTESLASGSSLLTLNKVPHDYGQEGPIEGKI"
     misc_feature    192..797
                     /gene="LOC101397259"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(234..236,240..245,249..254,261..272,495..497,
                     501..506,795..797)
                     /gene="LOC101397259"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    816..1121
                     /gene="LOC101397259"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(819..821,825..833,837..845,963..971,1008..1010,
                     1044..1046,1101..1103,1110..1112,1116..1118)
                     /gene="LOC101397259"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(825..830,834..836,873..875,879..881,885..887,
                     984..989,996..998,1002..1004)
                     /gene="LOC101397259"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(888..890,894..896,987..992)
                     /gene="LOC101397259"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    order(1683..1685,1689..1691,1701..1706,1713..1721,
                     1725..1730,1740..1742,1749..1751,1794..1796,1800..1802,
                     1806..1808,1818..1823,1830..1838,1842..1847,1857..1859,
                     1866..1868,1893..1895,1899..1901,1905..1907,1917..1922,
                     1929..1937,1941..1946,1956..1958,1965..1967)
                     /gene="LOC101397259"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1683..1796
                     /gene="LOC101397259"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1722..2189
                     /gene="LOC101397259"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:223738"
     misc_feature    1800..1895
                     /gene="LOC101397259"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2109..2198
                     /gene="LOC101397259"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2505..2726
                     /gene="LOC101397259"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
gctcaggcccgcgcccctggagggagcccccggcgcagggaggccgcgcggacccgccaccaggctccagaatggcagaagacgatccatatttgggagggcatgaacaaatgtttcatttggattctttgaatcatacaatatttaatccagaattatttcaacaagagatgccactaccgacagatggcccataccttcaaatattagagcaacccaaacagagaggatttcgtttccgttatgtctgtgaaggtccatcccatggtggactccccggtgcgtccagtgaaaagaacaagaagtcctaccctcaggtcaaaatctgcaactatgtgggacctgcaaaggttattgttcagttggtcacgaatggaaaaaacatccacttgcatgcacacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcccgaatgaccgaggcctgtgtaaggggctataatccaggacttttggtgcatcctgatcttgcctacttgcaggcggaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctcttcagcagaccaaggagatggacctcagtgtggtgcggctcatgtttacagcgtttcttccagacagcacgggcagcttcacgcggcgcctggagcccgtggtgtcagacgccatctatgacagcaaagcccccaacgcctccaacttgaagattgtaagaatggacaggacagctggatgcgtaactggaggggaagagatctatcttctctgtgacaaggttcaaaaagatgacatccagatccgattttatgaggaggaagagaatggtggagtctgggaaggatttggagacttttcccccacagacgttcatagacaatttgccatcgtcttcaagactccaaagtataaagatgtcaacattacaaaaccagcctctgtgttcgtccaacttcggaggaaatctgacttggaaactagcgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcctaacttctcggatagtttcggcggcggcagtggtgccggagctggaggtggcggcatgtttggcagtggcggtggaggagggggtgctggaagcacaggtccagggtacggctttccccactacggatttcctacatatggcggaattaccttccaccctggaaccactaaatctaatgctggtatgaagcatggaaccatagatgccccatgtaaaaatgaccctgaaagttgtgacgagagtgatgacagagagactgtaaatgtcttcgggaaagtaaccgaaaccacagcacaagataaggagtccagggatgaggatgatgaggttactctgacgcacgcagcaggagtaaagaaagagaattccaagtttcaggataacctctttctagagaaggctatgcagcttgccaagaggcatgccaatgccctttttgactatgcggtgacaggagacgtgaagatgctgctggctgtccagcgccatcttactgcagtgcaggatgagaatggggacagtgtcttacacttagcaatcatccaccttcatgctcaacttgtgagggacctgctagaagtcacatctggtttggtttctgatgacattatcaacatgagaaatgatctctaccagacaccgttgcacttggcggtgatcaccaagcaggaggctgtggtggaggacttgctgagggccggcgctgacctaagcctcctggaccgcttgggtaactcggttttgcacctagctgccaaagaaggacatgataaaattctcaatattttactcaagcacaaaaaggcagcactacttatcgaccaccccaatgcggaaggtctgaatgccatccacgtagccatgatgagcaacagcatgccgtgtctgctgctgctggtggccgccggggcggacgtcaacgcccaggagcggaagtcggggcgcacggcgctgcacctggctgcagagcacgacaacatctccctggccggctgcctgctcctggagggtgaagcccacgtagacagcaccacctacgatggaactacacccctgcacatcgcggcggggagagggtcgaccaggctggcagctcttctcaaagcagcaggagcagaccccctggtggagaactttgaacctctctatgacctggatgactcttgggaagaggatggagaggatgaaggagtcgtgcctggaaccacacctctagatatggccaccaactggcaggtatttgacatattaaatgggaaaccatatgagcccgagttgacatcagatggtttactggcacagggagacatgaaacagctgaatgaagatgccaagttgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaaattaggtctagggatactaaataatgccttccggctgagtcctgctccttctaagactctcatggacaactacgaggtctctggggggacagtaaaagagctggtggaggccctgagacagatgggctacactgaagccatcgaggtgatccagacagccttctgcagctcaggaactgcagcccccagcccagggaagaccacctgtcaggttccctcgctgcctctctcgcctgcctccacaaggcagcaaatagacgagctccgggaggacagcgtctgtgacagcggcgtggagacctccttccgcagactcagcttcacagagtctctggccagcggcagctcactgctgactcttaacaaagtgccccacgattacgggcaggaaggacctatagaaggcaaaatttagcccactggcgatttccaacaccatgtaaaccaaagctctgaaattccaccacagtgtccaaaagaaggaaggtcgagtgcatcccgaggtgctccgaggaaagctgcccacctggaccgttctggactccactcgaggctttagaaagccggcttccttccctggttcttagacgcgctttagccggggtcacgcacgatagcatctcgcagtccaggccccggctgggcggaggcctcactggggtgaggtggcttcttgaactttaccagctgctttctgttgtcattgctgctgtccctctgctgcgctcccactgtcattacaaggtgtcccagccccacccggggttctttctggccgtccacagcacggttgtgcattcagattaaggattaaagaaagggatattttaaaatgagaagactcacttggtgtataataaaaaaggcctactcctttttctgctgtggtta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]