2024-05-19 07:02:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_013831861 726 bp mRNA linear PLN 23-JUN-2022 DEFINITION PREDICTED: Brassica napus autophagy-related protein 8c (LOC106391255), transcript variant X4, mRNA. ACCESSION XM_013831861 VERSION XM_013831861.3 DBLINK BioProject: PRJNA844685 KEYWORDS RefSeq. SOURCE Brassica napus (rape) ORGANISM Brassica napus Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Brassiceae; Brassica. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_063447) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jun 23, 2022 this sequence version replaced XM_013831861.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Brassica napus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..726 /organism="Brassica napus" /mol_type="mRNA" /cultivar="Da-Ae" /db_xref="taxon:3708" /chromosome="C4" /tissue_type="Seedling" /dev_stage="Seedling" /country="USA" gene 1..726 /gene="LOC106391255" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 18 long SRA reads, 26 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 150 samples with support for all annotated introns" /db_xref="GeneID:106391255" CDS 256..615 /gene="LOC106391255" /codon_start=1 /product="autophagy-related protein 8c isoform X2" /protein_id="XP_013687315.2" /db_xref="GeneID:106391255" /translation="
MADISFKSEHPLERRQIEASRIRDKYPDRVPVIVEKAERSDVPNIDKKKFLVPADLTVGQFVYVVRKRIKLSAEKAIFVFVKNTLPQTAAMMSAVSDENKDEDGFLYMTYSGENTFGLV"
misc_feature 289..597 /gene="LOC106391255" /note="ubiquitin-like (Ubl) domain found in Saccharomyces cerevisiae Atg8p and related proteins; sub-family of the autophagy-related 8 (ATG8) family; Region: Ubl_ATG8; cd16128" /db_xref="CDD:340545" misc_feature order(307..309,316..321,340..342,382..396,400..414, 421..423,430..438,442..447,454..465,472..474,568..570) /gene="LOC106391255" /note="Atg19 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(307..309,319..321,340..342,346..354,394..396, 400..408,412..414,445..447,457..459,568..570) /gene="LOC106391255" /note="peptide binding site 2 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(307..309,340..342,346..348,394..396,400..408, 412..414,436..438,445..447,457..459,568..570) /gene="LOC106391255" /note="peptide binding site 1 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(340..342,367..372,394..396,403..405,430..435, 439..447,451..459,472..477,481..489,493..495,502..510, 514..522,592..597) /gene="LOC106391255" /note="Atg7 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(364..366,439..441,451..453,472..489,493..495, 502..519,580..582,586..597) /gene="LOC106391255" /note="Atg4 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature 457..459 /gene="LOC106391255" /note="key conserved lysine K33; other site" /db_xref="CDD:340545" polyA_site 726 /gene="LOC106391255" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
tacacctttccgggttacccaatagaacaaatggcaaaactaaaaagtttccaatgacgacgtgtcgataactaaaaaagatcaaagtttcatcctttcagagtttatcagcttcgcgcagcgattacaaatattcttcaaaccctaattgagttgtcttcttctatttcgacaatctaaattggagaacgagaaaccctaatcttagatttcaattggtgttgattgatttcaggaattcgattctcaatcgccatggctgatatctctttcaagtcggaacacccgctggagaggagacagattgaagcttctcgcatcagggacaagtatccagacagagttccagtgattgtagagaaagctgagagaagtgatgttcccaatatcgacaagaaaaagttccttgtaccggctgatctaaccgtggggcaatttgtgtatgttgtccgtaaaagaatcaagctgagtgcagaaaaggcaatctttgtctttgtcaagaacacattgcctcaaactgctgcaatgatgtctgcagtctctgatgagaacaaagacgaagatgggtttctctacatgacttatagtggagagaacacttttggtttggtttaaaatctgtctacttttgaagtgttttcatgtacatatatgctatgctctttgaatatggagaatttttttatgttgctttggactgattatatgtaaattttgctttggatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]