2024-05-19 06:06:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_013831859 756 bp mRNA linear PLN 23-JUN-2022 DEFINITION PREDICTED: Brassica napus autophagy-related protein 8c (LOC106391255), transcript variant X2, mRNA. ACCESSION XM_013831859 VERSION XM_013831859.3 DBLINK BioProject: PRJNA844685 KEYWORDS RefSeq. SOURCE Brassica napus (rape) ORGANISM Brassica napus Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Brassiceae; Brassica. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_063447) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jun 23, 2022 this sequence version replaced XM_013831859.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Brassica napus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..756 /organism="Brassica napus" /mol_type="mRNA" /cultivar="Da-Ae" /db_xref="taxon:3708" /chromosome="C4" /tissue_type="Seedling" /dev_stage="Seedling" /country="USA" gene 1..756 /gene="LOC106391255" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 10 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 134 samples with support for all annotated introns" /db_xref="GeneID:106391255" CDS 262..645 /gene="LOC106391255" /codon_start=1 /product="autophagy-related protein 8c isoform X1" /protein_id="XP_013687313.2" /db_xref="GeneID:106391255" /translation="
MADISFKSEHPLERRQIEASRIRDKYPDRVPVIVEKAERSDVPNIDKKKSVVYFCLRFLVPADLTVGQFVYVVRKRIKLSAEKAIFVFVKNTLPQTAAMMSAVSDENKDEDGFLYMTYSGENTFGLV"
misc_feature 295..627 /gene="LOC106391255" /note="ubiquitin-like (Ubl) domain found in Saccharomyces cerevisiae Atg8p and related proteins; sub-family of the autophagy-related 8 (ATG8) family; Region: Ubl_ATG8; cd16128" /db_xref="CDD:340545" misc_feature order(313..315,322..327,346..348,388..402,406..408, 433..444,451..453,460..468,472..477,484..495,502..504, 598..600) /gene="LOC106391255" /note="Atg19 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(313..315,325..327,346..348,352..360,400..402, 406..408,433..438,442..444,475..477,487..489,598..600) /gene="LOC106391255" /note="peptide binding site 2 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(313..315,346..348,352..354,400..402,406..408, 433..438,442..444,466..468,475..477,487..489,598..600) /gene="LOC106391255" /note="peptide binding site 1 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(346..348,373..378,400..402,433..435,460..465, 469..477,481..489,502..507,511..519,523..525,532..540, 544..552,622..627) /gene="LOC106391255" /note="Atg7 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(370..372,469..471,481..483,502..519,523..525, 532..549,610..612,616..627) /gene="LOC106391255" /note="Atg4 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" polyA_site 756 /gene="LOC106391255" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
tcccggtacacctttccgggttacccaatagaacaaatggcaaaactaaaaagtttccaatgacgacgtgtcgataactaaaaaagatcaaagtttcatcctttcagagtttatcagcttcgcgcagcgattacaaatattcttcaaaccctaattgagttgtcttcttctatttcgacaatctaaattggagaacgagaaaccctaatcttagatttcaattggtgttgattgatttcaggaattcgattctcaatcgccatggctgatatctctttcaagtcggaacacccgctggagaggagacagattgaagcttctcgcatcagggacaagtatccagacagagttccagtgattgtagagaaagctgagagaagtgatgttcccaatatcgacaagaaaaagtcagtagtatacttttgcttgaggttccttgtaccggctgatctaaccgtggggcaatttgtgtatgttgtccgtaaaagaatcaagctgagtgcagaaaaggcaatctttgtctttgtcaagaacacattgcctcaaactgctgcaatgatgtctgcagtctctgatgagaacaaagacgaagatgggtttctctacatgacttatagtggagagaacacttttggtttggtttaaaatctgtctacttttgaagtgttttcatgtacatatatgctatgctctttgaatatggagaatttttttatgttgctttggactgattatatgtaaattttgctttggatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]