2024-05-19 06:24:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_013778509 662 bp mRNA linear PLN 25-AUG-2015 DEFINITION PREDICTED: Brassica oleracea var. oleracea autophagy-related protein 8c (LOC106339658), transcript variant X4, mRNA. ACCESSION XM_013778509 VERSION XM_013778509.1 DBLINK BioProject: PRJNA293438 KEYWORDS RefSeq. SOURCE Brassica oleracea var. oleracea ORGANISM Brassica oleracea var. oleracea Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Brassiceae; Brassica. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_013617409.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Brassica oleracea Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..662 /organism="Brassica oleracea var. oleracea" /mol_type="mRNA" /variety="oleracea" /cultivar="TO1000" /db_xref="taxon:109376" /chromosome="C4" /country="Canada" /lat_lon="52.1333 N 106.6833 W" /collection_date="31-Aug-2009" gene 1..662 /gene="LOC106339658" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, 27 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 27 samples with support for all annotated introns" /db_xref="GeneID:106339658" CDS 214..573 /gene="LOC106339658" /codon_start=1 /product="autophagy-related protein 8c isoform X2" /protein_id="XP_013633963.1" /db_xref="GeneID:106339658" /translation="
MADISFKSEHPLERRQIEASRIRDKYPDRVPVIVEKAERSDVPNIDKKKFLVPADLTVGQFLYVVRKRIKLSAEKAIFVFVKNTLPQTAAMMSAVSDENKDEDGFLYMTYSGENTFGLV"
misc_feature 247..555 /gene="LOC106339658" /note="ubiquitin-like (Ubl) domain found in Saccharomyces cerevisiae Atg8p and related proteins; sub-family of the autophagy-related 8 (ATG8) family; Region: Ubl_ATG8; cd16128" /db_xref="CDD:340545" misc_feature order(265..267,274..279,298..300,340..354,358..372, 379..381,388..396,400..405,412..423,430..432,526..528) /gene="LOC106339658" /note="Atg19 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(265..267,277..279,298..300,304..312,352..354, 358..366,370..372,403..405,415..417,526..528) /gene="LOC106339658" /note="peptide binding site 2 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(265..267,298..300,304..306,352..354,358..366, 370..372,394..396,403..405,415..417,526..528) /gene="LOC106339658" /note="peptide binding site 1 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(298..300,325..330,352..354,361..363,388..393, 397..405,409..417,430..435,439..447,451..453,460..468, 472..480,550..555) /gene="LOC106339658" /note="Atg7 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(322..324,397..399,409..411,430..447,451..453, 460..477,538..540,544..555) /gene="LOC106339658" /note="Atg4 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature 415..417 /gene="LOC106339658" /note="key conserved lysine K33; other site" /db_xref="CDD:340545" ORIGIN
tacccaatagaacaaatggcaaaactaaaaagtttccaatgacgacgtgtcgataactaaaaaggatcaaagttccatcctttcagagtttatcagcttcgcgcagagattacaaatattcttcaaaccctaatcgagttgtcttcttctatttcgacaatctaaattggagaacgagaaaccgtaatcttaggaattcgattctcaatcgccatggctgatatctctttcaagtcggaacacccgctggagaggagacagattgaagcttctcgcatcagggacaagtatccagacagagttccagtgattgtagagaaagctgagagaagtgatgttcccaatatcgacaagaaaaagttccttgtaccggctgatctaaccgtggggcaatttttgtatgttgtccgtaaaagaatcaagctgagtgcagaaaaggcaatctttgtctttgtcaagaacacattgcctcaaactgctgcaatgatgtctgcagtctctgatgagaacaaagacgaagatgggtttctctacatgacttatagtggagagaacacttttggtttggtttaaaatctgtctacttttgaagtgttttcatgtacatatatgctatgctctttgaatatggagaatttttttatgttgctttggactgatta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]