2024-05-19 05:01:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_013778507 687 bp mRNA linear PLN 25-AUG-2015 DEFINITION PREDICTED: Brassica oleracea var. oleracea autophagy-related protein 8c (LOC106339658), transcript variant X2, mRNA. ACCESSION XM_013778507 VERSION XM_013778507.1 DBLINK BioProject: PRJNA293438 KEYWORDS RefSeq. SOURCE Brassica oleracea var. oleracea ORGANISM Brassica oleracea var. oleracea Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Brassiceae; Brassica. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_013617409.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Brassica oleracea Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..687 /organism="Brassica oleracea var. oleracea" /mol_type="mRNA" /variety="oleracea" /cultivar="TO1000" /db_xref="taxon:109376" /chromosome="C4" /country="Canada" /lat_lon="52.1333 N 106.6833 W" /collection_date="31-Aug-2009" gene 1..687 /gene="LOC106339658" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 26 samples with support for all annotated introns" /db_xref="GeneID:106339658" CDS 215..598 /gene="LOC106339658" /codon_start=1 /product="autophagy-related protein 8c isoform X1" /protein_id="XP_013633961.1" /db_xref="GeneID:106339658" /translation="
MADISFKSEHPLERRQIEASRIRDKYPDRVPVIVEKAERSDVPNIDKKKSVVYFCLRFLVPADLTVGQFLYVVRKRIKLSAEKAIFVFVKNTLPQTAAMMSAVSDENKDEDGFLYMTYSGENTFGLV"
misc_feature 248..580 /gene="LOC106339658" /note="ubiquitin-like (Ubl) domain found in Saccharomyces cerevisiae Atg8p and related proteins; sub-family of the autophagy-related 8 (ATG8) family; Region: Ubl_ATG8; cd16128" /db_xref="CDD:340545" misc_feature order(266..268,275..280,299..301,341..355,359..361, 386..397,404..406,413..421,425..430,437..448,455..457, 551..553) /gene="LOC106339658" /note="Atg19 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(266..268,278..280,299..301,305..313,353..355, 359..361,386..391,395..397,428..430,440..442,551..553) /gene="LOC106339658" /note="peptide binding site 2 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(266..268,299..301,305..307,353..355,359..361, 386..391,395..397,419..421,428..430,440..442,551..553) /gene="LOC106339658" /note="peptide binding site 1 [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(299..301,326..331,353..355,386..388,413..418, 422..430,434..442,455..460,464..472,476..478,485..493, 497..505,575..580) /gene="LOC106339658" /note="Atg7 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature order(323..325,422..424,434..436,455..472,476..478, 485..502,563..565,569..580) /gene="LOC106339658" /note="Atg4 interaction site [polypeptide binding]; other site" /db_xref="CDD:340545" misc_feature 440..442 /gene="LOC106339658" /note="key conserved lysine K33; other site" /db_xref="CDD:340545" ORIGIN
ttacccaatagaacaaatggcaaaactaaaaagtttccaatgacgacgtgtcgataactaaaaaggatcaaagttccatcctttcagagtttatcagcttcgcgcagagattacaaatattcttcaaaccctaatcgagttgtcttcttctatttcgacaatctaaattggagaacgagaaaccgtaatcttaggaattcgattctcaatcgccatggctgatatctctttcaagtcggaacacccgctggagaggagacagattgaagcttctcgcatcagggacaagtatccagacagagttccagtgattgtagagaaagctgagagaagtgatgttcccaatatcgacaagaaaaagtcagtagtatacttttgcttgaggttccttgtaccggctgatctaaccgtggggcaatttttgtatgttgtccgtaaaagaatcaagctgagtgcagaaaaggcaatctttgtctttgtcaagaacacattgcctcaaactgctgcaatgatgtctgcagtctctgatgagaacaaagacgaagatgggtttctctacatgacttatagtggagagaacacttttggtttggtttaaaatctgtctacttttgaagtgttttcatgtacatatatgctatgctctttgaatatggagaatttttttatgttgctttggactgatta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]