2024-05-19 08:41:08, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_013558122 4498 bp mRNA linear INV 28-FEB-2018 DEFINITION PREDICTED: Lingula anatina copper-transporting ATPase 1-like (LOC106175926), transcript variant X3, mRNA. ACCESSION XM_013558122 VERSION XM_013558122.2 DBLINK BioProject: PRJNA293030 KEYWORDS RefSeq. SOURCE Lingula anatina ORGANISM Lingula anatina Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Brachiopoda; Linguliformea; Lingulata; Lingulida; Linguloidea; Lingulidae; Lingula. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_019775502.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Feb 28, 2018 this sequence version replaced XM_013558122.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Lingula anatina Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4498 /organism="Lingula anatina" /mol_type="mRNA" /isolate="Amm_Jpn" /isolation_source="intertidal zone" /db_xref="taxon:7574" /chromosome="Unknown" /sex="male" /tissue_type="Gonads" /dev_stage="adult" /country="Japan: Amami, Kasari Bay" /lat_lon="28.4406 N 129.6676 E" /collection_date="2012" /collected_by="Nori Satoh, Kazuyoshi Endo" /identified_by="Kazuyoshi Endo" gene 1..4498 /gene="LOC106175926" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 6 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:106175926" CDS 4..4404 /gene="LOC106175926" /codon_start=1 /product="copper-transporting ATPase 1-like isoform X3" /protein_id="XP_013413576.1" /db_xref="GeneID:106175926" /translation="
MMSEAVISIQGMTCQSCVKNIEVNMAAFPGISTIEVSLENQEGVVSFDPTVTTAEKIAEGIDDMGFEAKVKSPGSSPQEVTIYIEGMTCQSCVKNIEGAISMRSGVKQIKVSLSQKQASIRYDPSQTNPRTLREHIDDMGFEAFLEKPKQTVNVKIGVEGMTCQSCVKNIEGNMSSKPGVRHIQVSLERKEANITYDPSVVTAQMLRDQINDMGFEATLPSNGSSTSFDEFHELAKTRSHADFGKCRLHIEGMTCQSCIKNIEGVIGEFPGVKTIKVTLETKSADVTFDSSIVTAQAVADRISDMGFDCNVADQQDEFDEIASRSAPTKSPPDGTLAKCMVDIEGMTCMSCVKNIEGTLSDEKGIAQVSVSLEEKRGTVQYDPALWSPTTVAERISDMGYDSVVHAAAIPKVPSTISTTVISIKGMTCNSCVKTIQEVISEKPGVRSIKVSLQEEQGVIQYDPDVTSPQQLRDAIDDMGFDACITDETKFPPETTVIMNGSAGPVKSTPSRGHLPKTNHGMVLQRKVDTVEEDDLEKCHLHVSGMTCASCVANIERNLLKVPGISSVLVALMAQKAEVKYDPAYMMPSQIATLVTELGYPAMLIENEGTGDGHLEIQIGGMTCSSCVHRIESHMVKQPGIKSAIVSLATNRGRFEFDPENTGPRDIMNEIRDMGYEASLVTDNSKNSAAHEHRKTTRQWRNSFLFSLILGVPCMVVMMYFMFAYMHMPGHQMAAGGSNDTADSSPGVPMVTAGLSVENLILFLLATPVQFIGGRYFYIQAYKALKHRSTNMDVLIVMATTISYVYSVIVVAVAMVMQESTSPRTFFETTPMLMVFISLGRWLEHIAKGKTSEALTKLMSLQASEALLLECDKNGQVIKEQRISVDLVHRGDILKVLPGEKIPVDGKVTEGHSMCDESLITGESMPVEKKKGSSVIGGSINQNGTLLVEATHVGADSALAQIVRLVEEAQTSKAPLQAVADTIAGYFVPGVCTISLLTAVVWVIVGYATYNQLDIHWKSESGMGKNEIIFQHAFKFAITVLAIACPCALGLATPTAVMVGTGVGATNGILIKGGEPLEIAHKVQSIVFDKTGTITRGIAELTRLTLFNTGLSKHLVIAVTGTAETSSEHPVAAAIVKYAKQALGAETLGKVLDFQAVPGCGLKCRVTNVDHLVSSMETKDILKEHTNIDRDEIQDLQDAPSSSGYEVLIGNREWMSRNMLTVTEAMDQEMSYHENKGETAVLCAINGEIVAMLAVADTVKEEAHLAVYTLKKMGLNVFLLTGDNLKTAKAIAKQVGISKVFAEVLPSHKVAKIKQLQKDGHRVAMVGDGVNDSPALAQADLGIAIGTGTDVAVEAAGVVLIRNDLLDVVAAMRLSKKTVRRIRFNFLAATIYNIVGIPVAAGALFPIGIELMPWMASAAMAASSVSVVCSSLLLKLFKMPRPEDLLTSEYKARQTSLLLFLSQLQET"
misc_feature 19..210 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(37..45,52..54) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 244..432 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(262..270,277..279) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 475..657 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(484..492,499..501) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 751..930 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(760..768,775..777) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1021..1206 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1039..1047,1054..1056) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1261..1449 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1279..1287,1294..1296) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1627..1806 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1636..1644,1651..1653) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1846..2037 /gene="LOC106175926" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1864..1872,1879..1881) /gene="LOC106175926" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2104..4242 /gene="LOC106175926" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3133..3135,3139..3141,4174..4176) /gene="LOC106175926" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3265..3273,3469..3471,3625..3633,3721..3723, 3841..3849,3907..3909,3916..3918,3925..3927,3982..3984, 3991..3993) /gene="LOC106175926" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
aagatgatgagtgaagcagtgatcagtatccaaggcatgacttgccagtcttgtgtgaaaaatatagaagtgaacatggcagcattccctggaatatccacaattgaggtttctctagaaaaccaggaaggtgttgtaagctttgatcccaccgttaccactgcagagaagattgctgagggaatagatgacatgggttttgaagccaaagttaagtcccctgggtcctccccccaggaagtgacaatctacatagagggaatgacctgtcagtcttgtgtcaaaaacatagagggtgccatcagcatgaggtcaggggtcaagcagatcaaggtatcattatcgcagaaacaggcgagcataaggtatgacccctctcagaccaatcctagaactctacgtgaacacatcgacgatatgggttttgaggcttttctggaaaaaccgaagcagacggtgaatgtgaaaattggagtagagggtatgacctgccagtcttgtgtcaagaatattgaagggaatatgtccagcaaaccgggagtgaggcacattcaagtttccctggagagaaaagaggccaatatcacgtatgacccctccgttgttacagcacagatgttacgagatcaaatcaatgacatggggtttgaggcaacacttcccagcaatggatcctcaacatcttttgatgaatttcatgaactcgctaagacaagaagccatgctgactttggcaaatgtaggttacacattgaggggatgacttgtcagtcgtgcattaagaacattgaaggggttatcggtgaattcccaggagtgaaaactatcaaggtgactttggagaccaaatctgctgatgttacttttgactccagcattgttactgcccaggcagtggcggatagaatatctgatatgggtttcgactgcaatgtggctgaccaacaggatgagtttgatgaaatagccagtagaagtgctcccacaaaatctcccccagatggcactctagccaagtgtatggttgatattgaagggatgacctgtatgtcttgtgttaagaacatcgagggtactctttctgatgagaaggggatcgcacaagtcagtgtttctctggaagagaaaaggggtacagtgcagtatgatcccgccctctggtcccccaccactgtggccgagagaatcagtgacatgggctatgattctgtagtccatgctgcagccattcctaaggtgccctccactatcagcacaactgtcatctccatcaaaggaatgacatgcaattcctgtgtgaagacaatccaggaagtgatttctgagaaaccaggggtgagatctataaaagtgtctctgcaggaagagcagggagttatccaatatgatcctgacgtcacgtcaccccagcagctgcgagacgccatagatgatatgggctttgatgcatgcatcacagatgagaccaaattcccaccagaaaccaccgtgataatgaacggcagtgcagggccagtgaagtccacgccttcacgcggccatctacccaagaccaaccatggcatggtcctacaaaggaaggtggacacagtggaagaggatgacctggagaaatgccacctccatgtgtctggaatgacctgtgcttcttgtgtggctaatattgagaggaacttactgaaagtgcctggtatttcttcagtgttggtggctttgatggcccagaaagcagaagtgaagtatgatcctgcctacatgatgccctcccagattgctaccctggtcacagaactgggctaccccgccatgctgatcgagaatgaaggaacaggtgatgggcaccttgaaatccagattggtggtatgacatgttcatcctgtgtccaccgtatagagtcccatatggtgaaacaaccaggcatcaagtctgccatagtttccctggctaccaataggggacgctttgagtttgatccagaaaacacaggaccaagagatattatgaatgaaataagggatatgggatatgaggcttccctggtcacagacaattccaagaattctgctgcacatgaacacaggaaaactaccaggcagtggagaaattcattcctgttttccctcatacttggtgtaccttgtatggtggtcatgatgtacttcatgtttgcttatatgcacatgcctggtcaccagatggcagcaggtggcagtaatgatacagctgattcctcgccaggtgtccccatggtgacagcaggactgtctgtggagaacttgattctatttttactggcaactcctgtacagtttattggtgggagatatttttatatccaagcctacaaagctttgaaacacagatccaccaatatggatgtccttattgtcatggcaaccacaatatcatatgtttactcagttattgttgtggctgttgccatggtgatgcaagagtccacaagcccacgtacattctttgagaccacacctatgttaatggtgtttatatcattgggacggtggcttgaacatatagcaaagggcaagacatcagaggccctgaccaagctgatgtctctgcaggccagtgaggctctactgctggagtgtgacaagaatggccaggtgatcaaggaacagaggatcagtgtggacttagttcacaggggagatattctcaaggtcctgcctggagagaagattccagtggatggtaaagtgacggagggacactccatgtgtgatgaatctcttatcactggagagtccatgcccgtggagaagaaaaaaggttcttctgtgattggaggatctatcaaccagaatggcactctgttggtggaagctacacatgtgggggcagacagtgctcttgctcaaatagtcaggcttgtggaagaagctcaaacatccaaagctcctctgcaggcagtggcagacaccatagctggctattttgtccctggggtttgcaccatctctctcctcacagctgtagtatgggttatagtgggctatgccacttataaccagttggacattcattggaaatcagaaagtggaatgggcaagaacgaaatcatcttccagcatgcgtttaagtttgccatcacagttctagcaatagcctgtccctgtgccctgggcctggccacacccactgctgttatggtggggacaggggtgggggctactaacgggatactcatcaagggaggagagccattagagattgcacacaaggtacagagtattgtgtttgacaagacaggcacaataacgcgtggtatagcagagttgactagactgacactgtttaatacagggttgtccaaacatctggtgattgctgtcactgggactgcagaaaccagcagtgaacaccctgtagctgcagccattgtcaaatatgccaaacaggcattgggtgcagagaccctgggcaaggtgttggatttccaagctgtcccaggctgtggcttgaagtgtagagtgaccaatgttgatcatctggtgagcagtatggaaacaaaggacattctcaaagaacacactaatattgacagagacgaaatacaagacctgcaagatgccccatcctccagtggctatgaggtattgataggtaacagggagtggatgagccgtaacatgctgacagtcactgaggccatggaccaggaaatgtcatatcatgaaaacaagggagaaactgcagtactctgtgcaattaatggtgagatagttgccatgctggccgtggcagacacagtgaaggaagaggctcaccttgctgtgtacacactgaagaaaatgggactcaatgttttcctcctcacaggagacaatctcaagacagctaaggcaatagccaaacaggttggcatcagtaaagtgtttgcggaagtgttaccatctcacaaagtggccaagatcaagcaactccagaaggacgggcaccgtgtggccatggtaggggatggggtcaatgattccccagccctggcacaggctgacctaggcattgccataggaacaggaactgatgttgccgtggaagcagcaggcgtggtgctaattaggaatgacctgttagatgtggtggcggccatgcgtctgtcaaagaagacagtgaggaggataaggttcaacttcctggctgctaccatctacaacatagtgggaatacctgtagctgctggtgctttattcccaattggtattgaattaatgccatggatggcctctgcagcaatggctgcctcatccgtgtctgtcgtctgctcttcattgttgctgaaacttttcaagatgccacgtcctgaagatcttctgacaagtgaatataaggccaggcaaacttcactcttactgttcctgtctcagcttcaagaaacctaacagagaggacctcctgacacaagagtactttcagaagttcagctcaggcagggacgagtatggggaggatgatatttctgtccactgcggtatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]