2024-05-19 10:56:58, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_010136884 1869 bp mRNA linear VRT 06-NOV-2014 DEFINITION PREDICTED: Buceros rhinoceros silvestris copper-transporting ATPase 2-like (LOC104494096), partial mRNA. ACCESSION XM_010136884 VERSION XM_010136884.1 DBLINK BioProject: PRJNA266010 KEYWORDS RefSeq. SOURCE Buceros rhinoceros silvestris ORGANISM Buceros rhinoceros silvestris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Bucerotiformes; Bucerotidae; Buceros. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_010413760.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Buceros rhinoceros silvestris Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on the 3' end. FEATURES Location/Qualifiers source 1..1869 /organism="Buceros rhinoceros silvestris" /mol_type="mRNA" /isolate="BGI_N320" /sub_species="silvestris" /db_xref="taxon:175836" /chromosome="Unknown" /sex="male" gene 1..>1869 /gene="LOC104494096" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 Proteins" /db_xref="GeneID:104494096" CDS 1..>1869 /gene="LOC104494096" /codon_start=1 /product="copper-transporting ATPase 2-like" /protein_id="XP_010135186.1" /db_xref="GeneID:104494096" /translation="
MERKLDNKMKRDLSCLATLSSKNITLVSVCKQQAAHDVPELLIIDEKSKAESLVTANSKSQNEEKHLQSYSMGMPEVSTVERQALSNTDSPPGCELEPTMKHRFAFDNMGYEESFETIPSSQECTVAVNVVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSEISPEQICQEIQDMGFDANTAEERLTTAVNSSCLKEAVVKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAVIAYCPHIIKPDDLKSHITNLGYDCSIKSKSAPLKLGVLNLQRLQNANPKETPESLESDGVDLLVAEMGSTATVAVQIEGMHCKSCVRNIEGNISDLPGIQSIKVSLEHKCAVVQYSPNLITLSALQQAIESLPPGNFKVCLLKGSEANKGASPSPALLCNLFREPLEDTTCTAVIRIDGMTCNSCVQSIEGTISQRQGVQCIAVSLSGRTGTIHYNPAVTNGEELRAAIEDMGFDASVLTDTATGGHGHQPDASNAVVQPRVPEPPRQGCASDALPDSARLDGPSQPSRATAEKCFLQIIGMTCASCVSTIERNLQKEVGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQKLGFEATVIEDHAETEGNVELL"
misc_feature 382..567 /gene="LOC104494096" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(397..405,412..414) /gene="LOC104494096" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 631..822 /gene="LOC104494096" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(649..657,664..666) /gene="LOC104494096" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 970..1143 /gene="LOC104494096" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(985..993,1000..1002) /gene="LOC104494096" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1267..1458 /gene="LOC104494096" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1285..1293,1300..1302) /gene="LOC104494096" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1636..1824 /gene="LOC104494096" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1651..1659,1666..1668) /gene="LOC104494096" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" ORIGIN
atggagagaaaactggacaataaaatgaaaagggacctgtcctgcttagctactttaagcagcaaaaacatcaccctggtgtctgtttgtaagcagcaggcagctcacgatgtgcctgaactactgattattgatgaaaagtccaaggcagaatctctggtaacagcaaacagtaagtcacagaacgaagagaaacatttgcagagttactccatgggaatgccagaagtcagcacagttgaaagacaggctttgtccaacaccgattctcctcctggctgtgagctggagcctacaatgaaacaccgttttgcttttgacaacatgggctatgaggagagctttgaaaccattccatcttcccaagagtgcactgtggcagtcaatgttgtgggaatgacttgccaatcatgtgtgcagtcaatagagggccgaatttccaaggtgaagggcattgtcagtattaaagtctcccttgaacagaacaatgctgtaataaagtatctgcagtcggaaataagtcctgaacagatttgccaggaaattcaggatatgggctttgatgccaacacagcagaagagaggttgacaacagcagtaaattcgtcatgcttgaaagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcatgcgtcaccaacattgaaggaaagattaggaaactacatggtgtggcgaaaatcaaggtgtcactcggtaaccaggaagcagttattgcttactgtcctcacatcattaagcctgacgacctcaagagccatatcactaacttgggctatgactgctccattaaaagtaaatcagcccctttgaagctgggtgtcctcaatctccagcgcttgcagaatgcaaaccccaaggagacaccagaaagtctcgagagtgatggggtggatctgctggtcgccgagatgggtagcacagctacggtggctgtgcagatagagggcatgcactgtaagtcctgcgtcagaaacattgaaggaaatatatcggatcttcctggcatacaaagtattaaagtatctttggagcataaatgtgctgtggtacagtatagcccaaatttaattaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaaaggttcagaagcaaataaaggagcatctccatcacctgctttgctatgcaatctcttcagagagccactggaagacacaacatgcacggctgttattaggattgatggcatgacctgcaattcttgcgtacagtccatagaagggaccatatcacagcgacaaggagtgcaatgtatagcagtttctctgtctggcagaactgggaccatacattataatccagctgttactaacggagaagagttaagagctgccatagaagacatggggtttgatgcttctgtgctaacagatacagccactggaggacatgggcaccagcctgatgccagcaatgctgtggtgcagcctcgagttccagagcctcctcgccaaggatgtgcctcagatgctcttccagacagtgctcgccttgatgggccaagccagcccagcagagcgacagctgaaaagtgttttttacaaatcataggcatgacctgtgcatcgtgtgtgtctaccatagaaagaaatttgcagaaagaagtcggaattgtttcagtgttggtagcactgatggcaggtaaggctgagataaagtacaagccagaattgatccagcctcttgaaatagcacagctgatccagaagttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttctt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]