LOCUS       XM_009867870            1878 bp    mRNA    linear   VRT 24-OCT-2014
DEFINITION  PREDICTED: Apaloderma vittatum copper-transporting ATPase 2-like
            (LOC104269173), partial mRNA.
ACCESSION   XM_009867870
VERSION     XM_009867870.1
DBLINK      BioProject: PRJNA263608
KEYWORDS    RefSeq.
SOURCE      Apaloderma vittatum (bar-tailed trogon)
  ORGANISM  Apaloderma vittatum
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Trogoniformes; Trogonidae;
            Apaloderma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_009692635.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Apaloderma vittatum Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..1878
                     /organism="Apaloderma vittatum"
                     /mol_type="mRNA"
                     /isolate="BGI_N311"
                     /db_xref="taxon:57397"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="Tanzania"
     gene            1..>1878
                     /gene="LOC104269173"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 Proteins"
                     /db_xref="GeneID:104269173"
     CDS             1..>1878
                     /gene="LOC104269173"
                     /codon_start=1
                     /product="copper-transporting ATPase 2-like"
                     /protein_id="XP_009866172.1"
                     /db_xref="GeneID:104269173"
                     /translation="

MERKLDNKMKRELSCLATLNNKNITLVSIHKQQAAHDVPELLIIGEKSKMGSPVKTSSNLQKEEKLLQSYSMGMKEVNTVERQALSNTDSPPDCKLEPTMKHSFAFDNLGYEESFEAVPSPSSQEHTVAVNVMGMTCQSCVQSIEGRISKVNGIVSIKVSLEQNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTATVNLSCLREAVVKLRVEGMTCQSCAINIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYLIQPDDLKSHISNLGYGCTIKSKSAPLKLGVLDVERLQNANPKETPASLEGDGVDLLVAKMSNTAAVAVRIEGMHCKSCVKNIEGNISDLPGIQSIRVSLEHKRAVVQYSPDLITLSALQQAIESLPPGNFKVCLPNGSEANRGASPSPALLCDPVREPLQDTCTAVIRIDGMTCNSCVQSVEGTILQRQGVQHVAVSLASGTGTICYDPAVTNGEELRAAIEDMGFDASVLTDAAAAGGCRYQPDASDVAVQPRAPEPPRQGCALDPHPDSPRLDRPNQPSGEPAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELL"

     misc_feature    388..573
                     /gene="LOC104269173"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(403..411,418..420)
                     /gene="LOC104269173"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    640..831
                     /gene="LOC104269173"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(658..666,673..675)
                     /gene="LOC104269173"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    979..1152
                     /gene="LOC104269173"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(994..1002,1009..1011)
                     /gene="LOC104269173"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1273..1464
                     /gene="LOC104269173"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1291..1299,1306..1308)
                     /gene="LOC104269173"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1645..1833
                     /gene="LOC104269173"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1660..1668,1675..1677)
                     /gene="LOC104269173"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
ORIGIN      

atggagagaaagctggacaataaaatgaaaagggaactgtcctgcttagctactttaaacaacaaaaacataaccctggtgtctattcataagcagcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaagatgggatctccggtaaaaacaagcagtaacttgcagaaagaagagaagcttttgcagagttactccatgggaatgaaagaagtcaatacagttgaaagacaggctttgtctaacactgattctccacctgactgcaagctggagcctacaatgaaacacagttttgcttttgacaacctgggctatgaagagagctttgaagctgtgccctctccatcttcccaggaacacactgtggcagttaatgtcatgggaatgacttgccagtcatgtgtgcagtcgatagaaggccgaatttctaaggtgaacggcatcgtgagtattaaagtctcccttgaacagaacaatgctgtaataaagtacctgcagtctgaaataagtcctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagaggttgacaacagcgaccgtaaatctgtcgtgcttgagagaagcagtagttaagcttcgtgtggaaggcatgacgtgccaatcctgtgccatcaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcgcttggtaaccaggaagcaattattgcgtattatccttacctcattcagcctgacgacctcaagagccatatcagtaacctgggctatggctgcaccattaaaagtaaatcagccccattgaagttgggtgtcctcgacgtcgagcgcttgcaaaatgcaaaccccaaggagacaccagcgagtctcgagggtgatggcgtagatctgctggtcgccaagatgagtaacacagctgcggtggctgtacggatagaaggcatgcactgcaagtcctgtgtcaaaaacattgaaggaaatatatcagatcttcctggcatacaaagtattagagtgtctttggagcataagcgtgctgtggtacagtatagcccagatttaattaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccctaatggttcagaagcaaatagaggagcatctccatcacctgctttgctgtgcgatcccgtcagagagccgctgcaggacacatgcacagctgttattaggattgatggcatgacctgcaattcttgtgtacagtccgtcgaagggaccatattgcagagacaaggagtgcaacacgtagcagtttctttagctagtggaactggaaccatatgttatgatccagctgttactaatggagaagagttaagagctgctatagaagacatggggtttgatgcttctgtgctgacagatgccgccgctgctggaggatgtaggtaccagcctgatgccagcgacgttgccgtgcagcctcgagctccagagcctcctcgccaaggctgtgccttggatcctcatccagacagtcctcgccttgacaggccaaaccagcccagcggagagccagctgaaaagtgtttcttacaaatcacaggcatgacctgtgcctcatgtgtgtctaccattgagagaaatttgcagaaagaagacggaattgtttcagtgttggtagcactgatggcgggtaaagccgagataaaatacaagccagaattcatacagcctcttgaaattgcacagctgatccagaatttgggttttgaagctacggtcatagaagatcatgcagaaacagaaggaaatgtggagcttctt

//