GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-16 17:27:18, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_009627292             821 bp    mRNA    linear   PLN 20-APR-2020
DEFINITION  PREDICTED: Nicotiana tomentosiformis uncharacterized LOC104116439
            (LOC104116439), mRNA.
ACCESSION   XM_009627292
VERSION     XM_009627292.2
DBLINK      BioProject: PRJNA257218
KEYWORDS    RefSeq.
SOURCE      Nicotiana tomentosiformis
  ORGANISM  Nicotiana tomentosiformis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; lamiids; Solanales; Solanaceae;
            Nicotianoideae; Nicotianeae; Nicotiana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008910633.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 20, 2020 this sequence version replaced XM_009627292.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Nicotiana tomentosiformis Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..821
                     /organism="Nicotiana tomentosiformis"
                     /mol_type="mRNA"
                     /bio_material="USDA:TW 142"
                     /db_xref="taxon:4098"
                     /chromosome="Unknown"
                     /tissue_type="leaf"
     gene            1..821
                     /gene="LOC104116439"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 17 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:104116439"
     CDS             253..600
                     /gene="LOC104116439"
                     /codon_start=1
                     /product="uncharacterized protein LOC104116439"
                     /protein_id="XP_009625587.1"
                     /db_xref="GeneID:104116439"
                     /translation="
MAFTNKHYLISLMILMVALQVQYICSDCLLLSGHSHGKTATQHSRKVLYMLKEKETEPITVTGSEITKQGHGYGETISTRNNGKNNKLELGVELREAPASPDPLHHHGNKPGIMP"
ORIGIN      
gcacagtctttttccggttaataatgcgtatctgatcttcttcttcttcttttctctgcaactatagcagttagctgctaatcatcatattctttacctctatctgtctaatcatgcatattagtgtgtctgaaacgctaaagctcctctataaattgcgatcagtattccaatatttacttcatctagaaaattaaattagtatttcttctgtttcatatttgtgtaagtggagtaaaaactttaattcacatggccttcactaacaagcactatctaatttctttgatgatattaatggtagccttgcaagtgcaatatatatgctcagactgtttattgctaagtggacactcacatggaaaaaccgccacgcaacacagcagaaaggtgctttacatgttgaaggagaaagagacagaaccaattactgtaactggaagtgaaattactaaacaaggacatggatatggagaaacaataagcacaaggaataatgggaagaacaataagttggaattaggtgtggaattaagagaagcacctgcgagtccagaccctttgcaccatcatgggaataaacctgggattatgccatagctgacactgcttactttacttctactactgtaatatttacttctgcacactaatcagcttgtttagttttctttttagttttcctttcttttttgggtctgacctttcaatgaggggttatagttctaagacaaatatgtaaacaggcttttaaaaacttgcaagaagcttttgctatgtaaaatatttcattttgttaattacctctttcttgtcaagaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]