GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 17:15:14, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_008992920            3555 bp    mRNA    linear   PRI 18-MAR-2023
DEFINITION  PREDICTED: Callithrix jacchus nuclear factor kappa B subunit 1
            (NFKB1), transcript variant X2, mRNA.
ACCESSION   XM_008992920
VERSION     XM_008992920.4
DBLINK      BioProject: PRJNA939228
KEYWORDS    RefSeq.
SOURCE      Callithrix jacchus (white-tufted-ear marmoset)
  ORGANISM  Callithrix jacchus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Platyrrhini; Cebidae; Callitrichinae; Callithrix; Callithrix.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_071444) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 18, 2023 this sequence version replaced XM_008992920.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_011100555.1-RS_2023_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/02/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3555
                     /organism="Callithrix jacchus"
                     /mol_type="mRNA"
                     /isolate="mCalJac1"
                     /db_xref="taxon:9483"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="juvenile"
                     /country="USA: New York"
                     /lat_lon="40.762676 N 73.955541 W"
                     /collection_date="2018-06-12"
                     /collected_by="Stephanie Marcus and Margaret Fabiszak"
     gene            1..3555
                     /gene="NFKB1"
                     /note="nuclear factor kappa B subunit 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 11 mRNAs, 256 ESTs, 3 long SRA reads, 5 Proteins"
                     /db_xref="GeneID:100415321"
     CDS             148..3054
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X2"
                     /protein_id="XP_008991168.1"
                     /db_xref="GeneID:100415321"
                     /translation="
MAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGSGGGGTGSTGPGYSFPHYGFPTYGGISFHPGTTKSNAGMKHGAMDSESKTDPEGCDKSDDRDTVNLCRKVTETTEQDQEPSKATDGNGEVTLTYATGTKEENAEVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDYPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVSGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
     misc_feature    271..876
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(313..315,319..324,328..333,340..351,574..576,
                     580..585,874..876)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    895..1200
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(898..900,904..912,916..924,1042..1050,1087..1089,
                     1123..1125,1180..1182,1189..1191,1195..1197)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(904..909,913..915,952..954,958..960,964..966,
                     1063..1068,1075..1077,1081..1083)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(967..969,973..975,1066..1071)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    order(1771..1773,1777..1779,1789..1794,1801..1809,
                     1813..1818,1828..1830,1837..1839,1882..1884,1888..1890,
                     1894..1896,1906..1911,1918..1926,1930..1935,1945..1947,
                     1954..1956,1981..1983,1987..1989,1993..1995,2005..2010,
                     2017..2025,2029..2034,2044..2046,2053..2055)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1771..1884
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1774..>2343
                     /gene="NFKB1"
                     /note="Transient Receptor Potential channel, Vanilloid
                     subfamily (TRPV); Region: TRPV; cl40437"
                     /db_xref="CDD:454755"
     misc_feature    1888..1983
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1903..2187
                     /gene="NFKB1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    2197..2286
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2590..2817
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
     polyA_site      3555
                     /gene="NFKB1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
ctcgctcgccccgacccgcacccgggcccgctcgggctccggccggccgccgcctcttccttctccagctcttaggcccgcgccgcccgggagggagagcccacccgcgacaggaagccgaacgctgactcgccacccggtttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtctgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgctcacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcatgtataaggggctacaatcctgggctcttggtgcaccctgaccttgcgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttaaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagataaagaagaagtgcagaggaaacgacaaaagctcatgcccaatttttcggatagtttcggcggtggtagtggtgctggagctggaggtggaggcatgtttggtagtggcagtggaggagggggcactggaagtacaggtccagggtatagcttcccacactatggatttcctacttatggagggatttccttccatcctggaactactaaatctaatgctgggatgaaacatggagccatggacagtgaatctaaaacggaccctgaaggttgtgacaaaagtgatgatagagacactgtaaacctctgtagaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccactgatgggaatggtgaggtcactctaacgtatgcaacaggaaccaaagaagagaatgctgaggttcaggataacctctttctagagaaggctatgcagcttgcgaagaggcatgccaatgcccttttcgactatgcagtgacaggagatgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactggaagtcacgtctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggccggggccgacctgagccttctggaccgcttcggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgactaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtccggacgcacagcactgcacctagctgtggagcacgacaacatctcattggctggctgcctgctccttgagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcggcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtatctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctaccctggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacactgaagcaattgaagtgatccaggcggcctccagcccagtgaagaccacctcgcaggcccactcgctgcctctctcgcctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaagctcagctttaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccgtgtaaaccaaagccctgaaattccactgtatcgtccacaagaagaaagctgaagcgcatccaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagtggatgcatctggggatgaggctgcttactgagctttgccggccactgctggatcacagctgctttctgttgtcattgttatttcccctctgctacgttcctgttttcattaaaggtatcactgtccccacctggcattccttctgaccatccatagcatcgttttgcattcaaattaagtgttaagaaagggatattttaaaatgagaatcacttgatgtgcaattttaaaaaaggcgtattactttttctaatgtggttatttctctgattt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]