2024-05-19 12:31:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_008528954 3671 bp mRNA linear MAM 14-JUL-2014 DEFINITION PREDICTED: Equus przewalskii nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1), transcript variant X2, mRNA. ACCESSION XM_008528954 VERSION XM_008528954.1 DBLINK BioProject: PRJNA253941 KEYWORDS RefSeq. SOURCE Equus przewalskii (Przewalski's horse) ORGANISM Equus przewalskii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Perissodactyla; Equidae; Equus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_007674350.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Equus przewalskii Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3671 /organism="Equus przewalskii" /mol_type="mRNA" /isolate="Burgud" /db_xref="taxon:9798" /chromosome="Unknown" /sex="male" /country="China: Xinjiang" /collection_date="12-Feb-2012" gene 1..3671 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 6 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 12 samples with support for all annotated introns" /db_xref="GeneID:103556719" CDS 22..3033 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X2" /protein_id="XP_008527176.1" /db_xref="GeneID:103556719" /translation="
MKDLQLLVDVLNWLLCGNGRQQYPMSDFGNVSRMAEDDPYLGGHEQMFHLESLNHTMFNPELFTQEVSLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKHTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACVRGYNPEILVHPDLRYLQAEGGGDRQLTDREKEVIHQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGGGGGGGGAGSTGPGYGFPHYGFPTYGGITFHPGAAKSNAGMKHGTIDTSCKNDPEGCDASDDREAVNLSGKGTETTARKESGGGADAIAPAPPAGAEEGRSCCQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRFGNSALHLAAKEGHDKILGILLKHKKAALLINHPNADGLNAIHIAMMSNSMPCLRLLVTAGADVNAQERKSGRTALHLAVERDNISLAGCLLLEGEAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWEENGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIKELVDALRQMGYTEAVEVIQAAFCTSGTAAPSPVTTTSQAPLLPLAPASTRQQIDELREDSVCDSGVETSFRRLSFTESLTSGSSLLTLNKMPHDYMQEGPIEGKI"
misc_feature 241..846 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(283..285,289..294,298..303,310..321,544..546, 550..555,844..846) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 865..1170 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(868..870,874..882,886..894,1012..1020,1057..1059, 1093..1095,1150..1152,1159..1161,1165..1167) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(874..879,883..885,922..924,928..930,934..936, 1033..1038,1045..1047,1051..1053) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(937..939,943..945,1036..1041) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1729..1842 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1768..2235 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:223738" misc_feature order(1852..1854,1864..1869,1876..1884,1888..1893, 1903..1905,1912..1914,1939..1941,1945..1947,1951..1953, 1963..1968,1975..1983,1987..1992,2002..2004,2011..2013, 2047..2049,2053..2055,2059..2061,2071..2076,2083..2091, 2095..2100,2110..2112,2119..2121) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1852..1941 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1945..2049 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2053..2145 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2155..2253 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2551..2775 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
tccctttctgatgctacctgaatgaaagatctccagcttttggtagatgtgctgaattggcttttatgtggaaatggaaggcagcaatatcccatgagtgacttcggtaacgtctccagaatggcagaagacgatccatatttgggaggtcatgaacaaatgtttcatttggagtctttgaatcatacaatgtttaatcccgaattatttacacaagaggtgtcactacccacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtgtgtgaaggcccatcccacggtggactgcccggtgcgtctagtgaaaagaacaagaagtcctaccctcaggtcaaaatctgcaactacgtgggacctgcaaaggttattgttcagttggtcacaaatggaaaacacacccacctgcatgcacacagtttagtgggaaaacactgtgaggacgggatctgcacggtgactgctggacccaaggacatggtggtcggttttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcccgaatgacagaggcctgtgtcaggggctataaccccgaaattttggtgcatcctgatcttcgttatttgcaggcagaaggcggaggagaccggcagctcacggatcgggaaaaggaggtcatccaccaggcagctcttcagcagacgaaggagatggacctcagcgtggtgcgactcatgttcacggcgtttcttccggacagcaccggcagcttcacacggcgcctggaacccgtggtgtcggacgccatctacgacagcaaagcccccaatgcctccaacttgaagattgtcaggatggacaggacagctggatgcgtgactggaggggaagagatttatcttctctgtgacaaggttcagaaagatgacatccagatccgattttatgaagaggaagaaaatggtggaatctgggaaggatttggagatttttcccctacagacgttcatagacaatttgccattgtcttcaagactccgaagtataaagatgtcaacattacaaaaccggcctccgtgttcgtccagcttcggaggaaatctgacttggaaaccagtgaaccaaaaccttttctctactatcctgaaatcaaagataaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcggatagtttcggcggcggcagtggggccggcgctggaggtggtggcatgtttggcggtggtggtggaggagggggtgctggaagcacaggtccagggtacggctttccgcactatggattccctacgtatggtggcattaccttccaccctggagctgcgaaatccaatgctgggatgaagcatggaaccatagacacctcgtgtaaaaatgaccctgaaggttgtgacgcaagtgatgacagagaggctgtaaatctctctgggaaaggaactgagaccacagcacgaaaggagtctggcggcggggctgatgccattgctccagcgcccccagcgggagcagaggaagggcgctcctgctgtcaggataacctgtttctagagaaggctatgcagcttgccaagcggcacgccaatgcccttttcgactacgcggtgacaggagatgtgaagatgctactggctgtccagcgccatctcactgcagtgcaggatgagaatggggacagtgtcttacacttagcgatcatccaccttcacgcccagcttgtgagggatctgctagaagtcacgtctggtttggtttctgatgacattatcaacatgagaaatgacctctaccagacgcccttgcatttggcagtgatcaccaagcaggaggctgtggtggaggacttgctgcgggccggggccgacctgagccttctggaccgcttcggtaactctgctttgcacctagctgccaaagaaggacatgataaaattctcggtattttactcaagcacaaaaaggcagcactacttatcaaccaccccaatgcggacggtctgaatgccattcacatagccatgatgagcaacagcatgccgtgtctgcggctgctggtgactgccggggcggacgtcaacgcccaggagcggaagtcggggcgcacggcgctgcacctggctgtggagcgggacaacatctccctggccggctgcctgctcctggagggtgaagcccatgttgacagtaccacctacgatggaactacacccctgcacatagcggccgggagagggtctacccggctggccgctctcctcaaagcagcaggagcagaccccttggtggagaacttcgagcctctctacgacctggatgactcttgggaagagaatggagaggacgaaggagtggtgcctggaaccacacccctagacatggccaccagctggcaggtatttgacatattaaatgggaaaccctatgagcccgagtttacatcagatgatttactggcacaaggagacatgaaacagctgactgaagatgcaaagttgcagctctacaagttgctagaaatccctgatccagacaaaaactgggccactctggcacagaaattaggtctggggatactaaataatgccttccggctgagtcctgccccgtctaagactcttatggacaactatgaggtctctggggggacgataaaagagctggtggacgccctgagacagatgggctacacagaagcagttgaagtgatccaggcagcattctgcacctcaggaaccgcagcccccagcccagtgacgaccacctcccaggcccccttgctgcctctcgcacctgcctccacaaggcagcaaatagacgagctccgggaggacagcgtctgtgacagtggcgtggagacctccttccgcagactcagcttcacggagtctctgaccagcggcagctcactgctaactcttaacaaaatgccccacgattacatgcaggaaggacctatagaagggaaaatttagcctgctggcaatttccaacaacatgtaaacgaaagctctgaaattccaccacgctgtccaagagaaggaaggccaagtgcagccaaaggtgctccaaggaaaccacctgctcggatcgttctggactccattcaaggccttggagagttggcttccttccctggctcttagctgagtttaattgggctcgtttacagatagtctcttgcaatcacggcacctggctgggctgaggcctcgctggggtgcggtggcttattgagctttaccagctgctttctgtggtcatcgctgctgtccctctgctgcattcccactgtcactaaaaggtgtcgcagtccgcacctggtgttctctctggccgtccaacgcacacttgtgcattcagattaaggattaagaaaagggatattttaaaatgagtcacttagtatataataaaaaaaggccccctgctttttctgatctggttatctctgtgattcgaaaaagaacatgtacatgtcaatatttaaacatggttacaatcagtgctggaaatggtattttcccctttttctgcattttgctattgtaaatatgtttttttagatcaaatactttaaaggaaaaaatattggatttataaatgctatttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]