GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 12:31:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_008528954            3671 bp    mRNA    linear   MAM 14-JUL-2014
DEFINITION  PREDICTED: Equus przewalskii nuclear factor of kappa light
            polypeptide gene enhancer in B-cells 1 (NFKB1), transcript variant
            X2, mRNA.
ACCESSION   XM_008528954
VERSION     XM_008528954.1
DBLINK      BioProject: PRJNA253941
KEYWORDS    RefSeq.
SOURCE      Equus przewalskii (Przewalski's horse)
  ORGANISM  Equus przewalskii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Perissodactyla; Equidae; Equus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_007674350.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Equus przewalskii Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3671
                     /organism="Equus przewalskii"
                     /mol_type="mRNA"
                     /isolate="Burgud"
                     /db_xref="taxon:9798"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="China: Xinjiang"
                     /collection_date="12-Feb-2012"
     gene            1..3671
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 12 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:103556719"
     CDS             22..3033
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X2"
                     /protein_id="XP_008527176.1"
                     /db_xref="GeneID:103556719"
                     /translation="
MKDLQLLVDVLNWLLCGNGRQQYPMSDFGNVSRMAEDDPYLGGHEQMFHLESLNHTMFNPELFTQEVSLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKHTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACVRGYNPEILVHPDLRYLQAEGGGDRQLTDREKEVIHQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGGGGGGGGAGSTGPGYGFPHYGFPTYGGITFHPGAAKSNAGMKHGTIDTSCKNDPEGCDASDDREAVNLSGKGTETTARKESGGGADAIAPAPPAGAEEGRSCCQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRFGNSALHLAAKEGHDKILGILLKHKKAALLINHPNADGLNAIHIAMMSNSMPCLRLLVTAGADVNAQERKSGRTALHLAVERDNISLAGCLLLEGEAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWEENGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIKELVDALRQMGYTEAVEVIQAAFCTSGTAAPSPVTTTSQAPLLPLAPASTRQQIDELREDSVCDSGVETSFRRLSFTESLTSGSSLLTLNKMPHDYMQEGPIEGKI"
     misc_feature    241..846
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(283..285,289..294,298..303,310..321,544..546,
                     550..555,844..846)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    865..1170
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(868..870,874..882,886..894,1012..1020,1057..1059,
                     1093..1095,1150..1152,1159..1161,1165..1167)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(874..879,883..885,922..924,928..930,934..936,
                     1033..1038,1045..1047,1051..1053)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(937..939,943..945,1036..1041)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1729..1842
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1768..2235
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:223738"
     misc_feature    order(1852..1854,1864..1869,1876..1884,1888..1893,
                     1903..1905,1912..1914,1939..1941,1945..1947,1951..1953,
                     1963..1968,1975..1983,1987..1992,2002..2004,2011..2013,
                     2047..2049,2053..2055,2059..2061,2071..2076,2083..2091,
                     2095..2100,2110..2112,2119..2121)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1852..1941
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1945..2049
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2053..2145
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2155..2253
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2551..2775
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
tccctttctgatgctacctgaatgaaagatctccagcttttggtagatgtgctgaattggcttttatgtggaaatggaaggcagcaatatcccatgagtgacttcggtaacgtctccagaatggcagaagacgatccatatttgggaggtcatgaacaaatgtttcatttggagtctttgaatcatacaatgtttaatcccgaattatttacacaagaggtgtcactacccacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtgtgtgaaggcccatcccacggtggactgcccggtgcgtctagtgaaaagaacaagaagtcctaccctcaggtcaaaatctgcaactacgtgggacctgcaaaggttattgttcagttggtcacaaatggaaaacacacccacctgcatgcacacagtttagtgggaaaacactgtgaggacgggatctgcacggtgactgctggacccaaggacatggtggtcggttttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcccgaatgacagaggcctgtgtcaggggctataaccccgaaattttggtgcatcctgatcttcgttatttgcaggcagaaggcggaggagaccggcagctcacggatcgggaaaaggaggtcatccaccaggcagctcttcagcagacgaaggagatggacctcagcgtggtgcgactcatgttcacggcgtttcttccggacagcaccggcagcttcacacggcgcctggaacccgtggtgtcggacgccatctacgacagcaaagcccccaatgcctccaacttgaagattgtcaggatggacaggacagctggatgcgtgactggaggggaagagatttatcttctctgtgacaaggttcagaaagatgacatccagatccgattttatgaagaggaagaaaatggtggaatctgggaaggatttggagatttttcccctacagacgttcatagacaatttgccattgtcttcaagactccgaagtataaagatgtcaacattacaaaaccggcctccgtgttcgtccagcttcggaggaaatctgacttggaaaccagtgaaccaaaaccttttctctactatcctgaaatcaaagataaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcggatagtttcggcggcggcagtggggccggcgctggaggtggtggcatgtttggcggtggtggtggaggagggggtgctggaagcacaggtccagggtacggctttccgcactatggattccctacgtatggtggcattaccttccaccctggagctgcgaaatccaatgctgggatgaagcatggaaccatagacacctcgtgtaaaaatgaccctgaaggttgtgacgcaagtgatgacagagaggctgtaaatctctctgggaaaggaactgagaccacagcacgaaaggagtctggcggcggggctgatgccattgctccagcgcccccagcgggagcagaggaagggcgctcctgctgtcaggataacctgtttctagagaaggctatgcagcttgccaagcggcacgccaatgcccttttcgactacgcggtgacaggagatgtgaagatgctactggctgtccagcgccatctcactgcagtgcaggatgagaatggggacagtgtcttacacttagcgatcatccaccttcacgcccagcttgtgagggatctgctagaagtcacgtctggtttggtttctgatgacattatcaacatgagaaatgacctctaccagacgcccttgcatttggcagtgatcaccaagcaggaggctgtggtggaggacttgctgcgggccggggccgacctgagccttctggaccgcttcggtaactctgctttgcacctagctgccaaagaaggacatgataaaattctcggtattttactcaagcacaaaaaggcagcactacttatcaaccaccccaatgcggacggtctgaatgccattcacatagccatgatgagcaacagcatgccgtgtctgcggctgctggtgactgccggggcggacgtcaacgcccaggagcggaagtcggggcgcacggcgctgcacctggctgtggagcgggacaacatctccctggccggctgcctgctcctggagggtgaagcccatgttgacagtaccacctacgatggaactacacccctgcacatagcggccgggagagggtctacccggctggccgctctcctcaaagcagcaggagcagaccccttggtggagaacttcgagcctctctacgacctggatgactcttgggaagagaatggagaggacgaaggagtggtgcctggaaccacacccctagacatggccaccagctggcaggtatttgacatattaaatgggaaaccctatgagcccgagtttacatcagatgatttactggcacaaggagacatgaaacagctgactgaagatgcaaagttgcagctctacaagttgctagaaatccctgatccagacaaaaactgggccactctggcacagaaattaggtctggggatactaaataatgccttccggctgagtcctgccccgtctaagactcttatggacaactatgaggtctctggggggacgataaaagagctggtggacgccctgagacagatgggctacacagaagcagttgaagtgatccaggcagcattctgcacctcaggaaccgcagcccccagcccagtgacgaccacctcccaggcccccttgctgcctctcgcacctgcctccacaaggcagcaaatagacgagctccgggaggacagcgtctgtgacagtggcgtggagacctccttccgcagactcagcttcacggagtctctgaccagcggcagctcactgctaactcttaacaaaatgccccacgattacatgcaggaaggacctatagaagggaaaatttagcctgctggcaatttccaacaacatgtaaacgaaagctctgaaattccaccacgctgtccaagagaaggaaggccaagtgcagccaaaggtgctccaaggaaaccacctgctcggatcgttctggactccattcaaggccttggagagttggcttccttccctggctcttagctgagtttaattgggctcgtttacagatagtctcttgcaatcacggcacctggctgggctgaggcctcgctggggtgcggtggcttattgagctttaccagctgctttctgtggtcatcgctgctgtccctctgctgcattcccactgtcactaaaaggtgtcgcagtccgcacctggtgttctctctggccgtccaacgcacacttgtgcattcagattaaggattaagaaaagggatattttaaaatgagtcacttagtatataataaaaaaaggccccctgctttttctgatctggttatctctgtgattcgaaaaagaacatgtacatgtcaatatttaaacatggttacaatcagtgctggaaatggtattttcccctttttctgcattttgctattgtaaatatgtttttttagatcaaatactttaaaggaaaaaatattggatttataaatgctatttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]