2024-05-19 11:49:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_007684986 735 bp mRNA linear PLN 05-JAN-2024 DEFINITION Bipolaris oryzae ATCC 44560 uncharacterized protein (COCMIDRAFT_32444), partial mRNA. ACCESSION XM_007684986 VERSION XM_007684986.1 DBLINK BioProject: PRJNA245121 BioSample: SAMN02981450 KEYWORDS RefSeq. SOURCE Bipolaris oryzae ATCC 44560 ORGANISM Bipolaris oryzae ATCC 44560 Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Bipolaris. REFERENCE 1 (bases 1 to 735) AUTHORS Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Ohm,R.A., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C., Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J., Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A., Lindquist,E., Barry,K., Schmutz,J., Baker,S.E., Ciuffetti,L.M., Grigoriev,I.V., Zhong,S. and Turgeon,B.G. TITLE Comparative genome structure, secondary metabolite, and effector coding capacity across Cochliobolus pathogens JOURNAL PLoS Genet. 9 (1), E1003233 (2013) PUBMED 23357949 REFERENCE 2 (bases 1 to 735) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (29-DEC-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 735) AUTHORS Ohm,R.A., Condon,B.J., Leng,Y., Wu,D., Bushley,K.E., Otillar,R., Martin,J., Schackwitz,W., Grimwood,J., MohdZainudin,N., Xue,C., Wang,R., Manning,V.A., Dhillon,B., Tu,Z.J., Steffenson,B.J., Salamov,A., Sun,H., Lowry,S., LaButti,K., Han,J., Copeland,A., Lindquist,E., Barry,K., Schmutz,J., Baker,S., Ciuffetti,L.M., Grigoriev,I.V., Zhong,S., Nordberg,B.G., Cantor,M.N. and Hua,S.X. CONSRTM DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (18-SEP-2013) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_006911282). ##Metadata-START## Organism Display Name :: Cochliobolus miyabeanus WK-1C, ATCC 44560 GOLD Stamp ID :: Gr00268 ##Metadata-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..735 /organism="Bipolaris oryzae ATCC 44560" /mol_type="mRNA" /strain="ATCC 44560" /culture_collection="ATCC:44560" /db_xref="taxon:930090" /chromosome="Unknown" gene <1..>735 /locus_tag="COCMIDRAFT_32444" /db_xref="GeneID:19122106" CDS 1..735 /locus_tag="COCMIDRAFT_32444" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_007683176.1" /db_xref="GeneID:19122106" /db_xref="InterPro:IPR001424" /db_xref="InterPro:IPR006121" /db_xref="JGIDB:Cocmi1_32444" /translation="
MAVTPFETIFAVPMTCQSCINDIEGSLHQLSGINKVTANLEEQLVSIEGTAAPSAIVEAIQATGRDAVLRGSGKSDSAAVCILESHAPQVENKVRGLVRMVEVSPGMTIVDLSIRGLSPGTYHATVRESGNISEGPESTGGIWELGQSQKATKPCRGIFGTVQVGKGGVGWVFLDKPIHIWEVIGRSIVVAREQDGKFDKNDADTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
misc_feature 22..699 /locus_tag="COCMIDRAFT_32444" /note="copper, zinc superoxide dismutase; Region: PLN02957" /db_xref="CDD:215516" ORIGIN
atggcggtaacaccctttgaaacgatattcgcagtgcccatgacctgtcagtcgtgcatcaacgacatcgagggttccctacaccagttgagtggtatcaacaaagtgactgccaacctcgaggagcaattagtgtctatcgagggcacagcagcgccgtcggccattgtagaggcgattcaagctactgggcgtgatgctgtccttcgggggtcaggcaaatcagacagtgcagcggtatgcattctagaatcacatgcgccacaggtggagaacaaggttcgcggcctggtgcgcatggtggaagtttctcctggtatgaccattgtggacttgagtataagagggttgtcacctggaacctatcatgctacagtacgtgagtcgggaaacatttccgagggacctgaatcgactggtggaatttgggaacttggtcagtcacaaaaggcgaccaagccttgtcgaggcatctttggaaccgttcaggttggaaagggtggagtaggatgggtgtttctcgacaagcctatccacatctgggaagtgattggacgcagcattgtggttgcgagagagcaggatggcaagtttgacaagaacgatgcggacacccttgttggggtcattgcacgcagtgcgggtgtatgggataacgacaagacagtgtgttcatgttcgggcaagacggtatggcaggagcgcgaggagcagcgcgatcgcggtatgctctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]