2024-05-19 10:04:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_006872726 3183 bp mRNA linear MAM 19-FEB-2014 DEFINITION PREDICTED: Chrysochloris asiatica nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1), mRNA. ACCESSION XM_006872726 VERSION XM_006872726.1 DBLINK BioProject: PRJNA232768 KEYWORDS RefSeq. SOURCE Chrysochloris asiatica (Cape golden mole) ORGANISM Chrysochloris asiatica Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Afrotheria; Chrysochloridae; Chrysochlorinae; Chrysochloris. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_006408729.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Chrysochloris asiatica Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 5.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3183 /organism="Chrysochloris asiatica" /mol_type="mRNA" /db_xref="taxon:185453" /chromosome="Unknown" /sex="female" /tissue_type="Spleen" /country="South Africa" gene 1..3183 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 18 Proteins" /db_xref="GeneID:102812842" CDS 1..3183 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit" /protein_id="XP_006872788.1" /db_xref="GeneID:102812842" /translation="
MAEDDPYMIGHEQMFHLDPLTHTMFNPDLFQPEMPLPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYMGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMIDACIRGYNPGLLVHPELVYLQAEGGGDRQLTDREKEIIRQAALHQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDINITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGAGSTGPGYGFSAYGFPTYGGITFHSGTTKSNAGMKHEALGTPCKKDHETCDGSDDRDAKNLSGKVTETTEQDKESSNGPDGVTLTYTVGVKEENCRFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVKDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEDVVENLLVAGADLSLLDRLGNSVLHLAAKEGHDKILSILLQHKMAALLINHPNGDGLNAIHIAIMSNSMPCLRLLVAASADVDAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAQVDSTTFDGTTPLHIAAGRGSSKLAALLKAAGADPLVENFEPLYDLDDSWERDGEDEGVIPGTTPLDMAANWQVFDILNGKPYESELTSDDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQTAFCSSGKTTTSSTKTPSQSHLLPLSPSSTRQQIDELRDNESICDSGVETSFHKLSFTESLTSSSSLLTLNKMPHDYGQQGSIEGIWLSGSCWDDGLINRKQGEPRDTCGSFQWTQPENASCVTSSHIAQEKNFSPLATSIKEWSVFVPSNNLFFRRCFQDSFLVFDFAEFDYD"
misc_feature 124..729 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(166..168,172..177,181..186,193..204,427..429, 433..438,727..729) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 748..1053 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(751..753,757..765,769..777,895..903,940..942, 976..978,1033..1035,1042..1044,1048..1050) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(757..762,766..768,805..807,811..813,817..819, 916..921,928..930,934..936) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(820..822,826..828,919..924) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature <1603..1827 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature order(1615..1617,1621..1623,1633..1638,1645..1653, 1657..1662,1672..1674,1681..1683,1726..1728,1732..1734, 1738..1740,1750..1755,1762..1770,1774..1779,1789..1791, 1798..1800,1825..1827,1831..1833,1837..1839,1849..1854, 1861..1869,1873..1878,1888..1890,1897..1899) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1615..1728 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1732..1827 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1747..2031 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 1939..2031 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1954..>2184 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 2041..2139 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2437..2658 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
atggcagaagacgatccatatatgatagggcatgaacaaatgtttcatttggatccactaactcatacaatgtttaatccagatttatttcaaccagaaatgccactaccaacagcagatggtccgtaccttcaaatattagaacaacctaaacagagaggatttcgtttccgttatgtatgtgagggaccatcccatggtggacttcctggtgcatctagtgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatatgggacctgcaaaggttattgttcaactggtcacaaatggaaaaaacatccacctgcatgcacacagcctggtggggaaacactgtgaggatggaatatgtacagtgaccgctggacccaaggatatggtggttggctttgcaaacctgggtattcttcatgtaacaaagaaaaaagtatttgagacactggaagcacgaatgatagatgcttgtataagaggctataaccctggacttttagtgcatccggaacttgtctatttgcaagcagaaggtggcggagacaggcaactcacagatcgggaaaaggagatcatccgccaggctgctcttcatcagacaaaagagatggacctcagcgtggtacggctcatgtttacagcttttctcccggatagcactggcagcttcacaagacgcctggagcccgtggtatcagatgccatctacgacagcaaagcccccaatgcatccaacttgaaaattgtaagaatggaccggacagccggatgtgttactggaggagaagagatttatcttctctgtgacaaggttcagaaagatgacatacaaattcgattttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccccacagacgttcataggcagtttgccattgtcttcaaaaccccaaagtataaagacatcaacattacaaaaccagcctctgtgttcgtccaacttcgaaggaaatctgatttagaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaacttttcagatagtttcggtggtggtagtggtgctggagctggaggtggaggcatgtttggtagtggcggtggaggagggggtgctggaagtactggcccaggatatggcttctccgcctatggatttcctacctatggtggaatcaccttccattctggaaccactaaatctaatgctgggatgaaacatgaagccttaggtacaccctgtaagaaggaccatgaaacttgtgatggaagtgatgacagagatgctaaaaatctttctgggaaagtaactgaaaccacagaacaagataaggagtctagcaatgggcctgatggggttacgctgacgtatacagtaggagtaaaggaagaaaattgtaggtttcaggataacctctttctagagaaggctatgcagcttgcaaagcggcacgccaatgccctttttgactatgcggtcacaggagatgtgaaaatgctgctggctgtccagcgccatcttactgcagtgcaggatgagaatggggacagcgttttgcacttagcaatcattcaccttcatgctcaacttgtgaaggatctgctagaagtcacgtcaggtttggtttctgatgacatcatcaacatgagaaatgatctttaccagacacctttgcacttagcagtgatcaccaagcaagaagatgtggtagagaacttgctggtggctggggctgacctaagtcttctggaccgcttgggtaattctgttttacacctagctgccaaagaaggacatgataaaattctcagcatcttactccagcacaaaatggcagcactacttatcaaccatcccaatggagacggtctgaatgccattcacatagccataatgagcaacagcatgccatgtctgcggctgctggtggctgccagcgcagatgtggacgctcaagagcagaagtctgggcgcacagcactgcacctggctgtggaacacgacaacatctccttggctggctgcctgctcctggagggtgatgctcaagtggacagcaccacctttgatgggactacacccttgcatatcgcggctgggagagggtcctccaaattggcagctcttctcaaagcagcaggagcagatcctttggtggagaattttgagcctctctatgacctggatgactcttgggaaagggatggagaggatgaaggtgtcatacctggaaccacacctttagatatggctgccaactggcaggtttttgacatattaaatgggaaaccatacgagtcagagcttacatctgatgatttactggcacaaggagacatgaaacagctgactgaagatgcaaagttgcagctctacaagttgctagaaatcccagatccagacaaaaactgggccaccctggcacagaaattaggtctaggaatacttaacaatgccttccgactgagtcccgcaccttctaaaactcttatggacaactatgaggtctctggaggaacagtaaaggaactggtagaggccctgagacagatgggctacactgaagcaattgaagtcatccagacagccttctgcagctcaggaaagacaaccaccagctcaaccaagacgccctctcagtcccacttgctgcctctctcaccttcctccacaaggcagcaaatagatgagctccgagacaacgaaagcatctgtgacagcggcgtggagacctccttccacaaactcagcttcacagagtctctgaccagcagtagctcattgctaactctgaacaaaatgccccacgattatgggcagcaaggatctatagaagggatttggctctcaggctcttgctgggatgatggccttatcaaccggaagcagggagagcccagagatacatgtgggagttttcagtggacccagcctgaaaatgcttcttgtgtcacttcttctcacattgcacaggagaaaaactttagtcctctggccacatctatcaaggagtggtccgtatttgttcccagtaacaatttgtttttccggagatgctttcaagattctttccttgtctttgactttgcagaattcgattatgattag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]