GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 09:19:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_006674532             597 bp    mRNA    linear   PLN 02-JAN-2024
DEFINITION  Cordyceps militaris CM01 uncharacterized protein (CCM_09398),
            partial mRNA.
ACCESSION   XM_006674532
VERSION     XM_006674532.1
DBLINK      BioProject: PRJNA225510
            BioSample: SAMN02981304
KEYWORDS    RefSeq.
SOURCE      Cordyceps militaris CM01
  ORGANISM  Cordyceps militaris CM01
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Hypocreomycetidae; Hypocreales; Cordycipitaceae;
            Cordyceps.
REFERENCE   1  (bases 1 to 597)
  AUTHORS   Zheng,P., Xia,Y., Xiao,G., Xiong,C., Hu,X., Zhang,S., Zheng,H.,
            Huang,Y., Zhou,Y., Wang,S., Zhao,G.P., Liu,X., St Leger,R.J. and
            Wang,C.
  TITLE     Genome sequence of the insect pathogenic fungus Cordyceps
            militaris, a valued traditional chinese medicine
  JOURNAL   Genome Biol. 12 (11), R116 (2011)
   PUBMED   22112802
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 597)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (28-DEC-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 597)
  AUTHORS   Zheng,P., Xia,Y., Xiao,G., Xiong,C., Shi,S., Huang,W., Shang,Y.,
            Hu,X., Li,L., Gao,Q., Zhang,S., Duan,Z., Wang,B., Zheng,H.,
            Huang,Y., Zhou,Y., Wang,S., Zhao,G.-P. and Wang,C.
  CONSRTM   Cordyceps militaris genome sequencing Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2011) Institute of Plant Physiology and Ecology,
            Shanghai Institutes for Biological Sciences, Chinese Academy of
            Sciences, 300 Fenglin Road, Shanghai 200032, China
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_006271977).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..597
                     /organism="Cordyceps militaris CM01"
                     /mol_type="mRNA"
                     /strain="CM01"
                     /db_xref="taxon:983644"
                     /chromosome="Unknown"
     gene            <1..>597
                     /locus_tag="CCM_09398"
                     /db_xref="GeneID:18171401"
     CDS             1..597
                     /locus_tag="CCM_09398"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_006674595.1"
                     /db_xref="GeneID:18171401"
                     /translation="
MLNLHPSPVLAAAILSLLTTPVLGVDTCSTDASRWDYWWYGSGPRYNCAEHNVCHISHIDQRTIGWSVTQGGSLGFNLAKSAALGFQSSYTWSESTTTGTTYSVDYYPPETERLWIKQWFAVLDMTCQSCDWVCYPMGQSVDNETDTGLNVGGQHCDRACDPHRHVIAWVPCRDSSCTEYQFSNADAQCDHSNHCQQN"
ORIGIN      
atgctcaacctgcatccatctcccgttctcgcagcggctatcctctcactgctcaccactccggtcctcggcgtggacacttgcagtaccgatgcctctcgctgggattactggtggtatggcagcggcccgcgctacaactgtgctgaacacaacgtctgccacatatcccatatcgaccaaaggacaatcgggtggtccgtcacccaaggcggctccctgggctttaatctggccaagtcggcagcacttggtttccagagcagctacacctggagcgagagcacgacgactggtaccacctacagcgtggactactatccgccagagacggagaggctgtggatcaagcagtggttcgctgtgctcgatatgacgtgccagagttgcgattgggtgtgctatcccatgggtcagagcgtggacaatgagacggacactggcttgaacgttggcggtcagcactgcgaccgcgcatgcgacccccatagacatgtcatcgcgtgggtgccatgccgtgattcatcttgcaccgagtaccaattcagcaatgcggatgcccagtgcgaccattcgaaccattgccagcaaaactga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]