LOCUS       XM_005853019             438 bp    mRNA    linear   MAM 04-NOV-2015
DEFINITION  PREDICTED: Myotis brandtii sodium/potassium-transporting ATPase
            subunit alpha-3-like (LOC102260737), partial mRNA.
ACCESSION   XM_005853019
VERSION     XM_005853019.1
DBLINK      BioProject: PRJNA218631
KEYWORDS    RefSeq.
SOURCE      Myotis brandtii (Brandt's bat)
  ORGANISM  Myotis brandtii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Vespertilionidae; Myotis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_005326159.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Myotis brandtii Annotation Release
                                           101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..438
                     /organism="Myotis brandtii"
                     /mol_type="mRNA"
                     /db_xref="taxon:109478"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="Russia: Perm poKrai"
                     /lat_lon="58.8348 N 57.6119 E"
                     /collection_date="Dec-2011"
                     /note="collected at hibernation roost"
     gene            <1..>438
                     /gene="LOC102260737"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 30% coverage of the
                     annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:102260737"
     CDS             <1..>438
                     /gene="LOC102260737"
                     /codon_start=1
                     /product="sodium/potassium-transporting ATPase subunit
                     alpha-3-like"
                     /protein_id="XP_005853081.1"
                     /db_xref="GeneID:102260737"
                     /translation="

VIMVTGDHPITAKAIAKGVGIISEGNETEEDIADRLKIPVDQVNSRDAKAIVVHGSKLKDLNSEQLDYILQNHTEIVFARTSPQQKLIIVEGCQRLGAIVAVTGDGVNDSPALKKADIGIAMGISGSDVSKQAADMILLDDNFASI"

     misc_feature    <1..>438
                     /gene="LOC102260737"
                     /note="sodium or proton efflux -- potassium uptake
                     antiporter, P-type ATPase, alpha subunit; Region:
                     ATPase-IIC_X-K; TIGR01106"
                     /db_xref="CDD:273445"
ORIGIN      

gtgattatggtgacgggggatcatcccatcacagccaaggccattgccaagggtgtgggcatcatctcagaaggtaatgagaccgaagaggacattgctgaccggctcaagatccctgtcgaccaggtcaatagcagggatgccaaagccattgtggtgcacggctcaaaactaaaggatctgaactcagaacagcttgactatatcctccaaaaccacacggagattgtgtttgctcggacctccccgcagcagaagctcatcattgtagagggatgtcagaggctgggagccatcgtggcggtgacgggcgacggggtgaacgactccccggcgctgaagaaggcggacatcggcatcgccatgggcatctcgggctccgacgtctctaagcaggcagccgacatgatcctgctggacgacaacttcgcctccatc

//