2024-06-02 07:01:19, GGRNA.v2 : RefSeq release 223 (Mar, 2024)
LOCUS NM_001368357 2104 bp mRNA linear ROD 10-FEB-2024 DEFINITION Mus musculus double C2, alpha (Doc2a), transcript variant 4, mRNA. ACCESSION NM_001368357 XM_017321967 VERSION NM_001368357.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 2104) AUTHORS Wang,Q.W., Qin,J., Chen,Y.F., Tu,Y., Xing,Y.Y., Wang,Y., Yang,L.Y., Lu,S.Y., Geng,L., Shi,W., Yang,Y. and Yao,J. TITLE 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin JOURNAL Cell Rep 42 (7), 112691 (2023) PUBMED 37354460 REMARK GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin. REFERENCE 2 (bases 1 to 2104) AUTHORS Bourgeois-Jaarsma,Q., Miaja Hernandez,P. and Groffen,A.J. TITLE Ca2+ sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons JOURNAL Mol Cell Neurosci 112, 103613 (2021) PUBMED 33753311 REMARK GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons. REFERENCE 3 (bases 1 to 2104) AUTHORS Diez-Arazola,R., Meijer,M., Bourgeois-Jaarsma,Q., Cornelisse,L.N., Verhage,M. and Groffen,A.J. TITLE Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons JOURNAL J Neurosci 40 (13), 2606-2617 (2020) PUBMED 32098902 REMARK GeneRIF: Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons. REFERENCE 4 (bases 1 to 2104) AUTHORS Bourgeois-Jaarsma,Q., Verhage,M. and Groffen,A.J. TITLE Doc2b Ca2+ binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength JOURNAL Sci Rep 9 (1), 14408 (2019) PUBMED 31594980 REMARK GeneRIF: Doc2b Ca(2+) binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength. Publication Status: Online-Only REFERENCE 5 (bases 1 to 2104) AUTHORS Courtney,N.A., Briguglio,J.S., Bradberry,M.M., Greer,C. and Chapman,E.R. TITLE Excitatory and Inhibitory Neurons Utilize Different Ca2+ Sensors and Sources to Regulate Spontaneous Release JOURNAL Neuron 98 (5), 977-991 (2018) PUBMED 29754754 REMARK GeneRIF: Doc2alpha promoted glutamatergic spontaneous neurotransmitter release, while Doc2beta and syt1 both regulated GABAergic spontaneous neurotransmitter release. REFERENCE 6 (bases 1 to 2104) AUTHORS Groffen,A.J., Friedrich,R., Brian,E.C., Ashery,U. and Verhage,M. TITLE DOC2A and DOC2B are sensors for neuronal activity with unique calcium-dependent and kinetic properties JOURNAL J Neurochem 97 (3), 818-833 (2006) PUBMED 16515538 REFERENCE 7 (bases 1 to 2104) AUTHORS Toonen,R.F., de Vries,K.J., Zalm,R., Sudhof,T.C. and Verhage,M. TITLE Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1 targeting and SNARE complex formation JOURNAL J Neurochem 93 (6), 1393-1400 (2005) PUBMED 15935055 REFERENCE 8 (bases 1 to 2104) AUTHORS Bouwman,J., Maia,A.S., Camoletto,P.G., Posthuma,G., Roubos,E.W., Oorschot,V.M., Klumperman,J. and Verhage,M. TITLE Quantification of synapse formation and maintenance in vivo in the absence of synaptic release JOURNAL Neuroscience 126 (1), 115-126 (2004) PUBMED 15145078 REFERENCE 9 (bases 1 to 2104) AUTHORS Sakaguchi,G., Manabe,T., Kobayashi,K., Orita,S., Sasaki,T., Naito,A., Maeda,M., Igarashi,H., Katsuura,G., Nishioka,H., Mizoguchi,A., Itohara,S., Takahashi,T. and Takai,Y. TITLE Doc2alpha is an activity-dependent modulator of excitatory synaptic transmission JOURNAL Eur J Neurosci 11 (12), 4262-4268 (1999) PUBMED 10594652 REFERENCE 10 (bases 1 to 2104) AUTHORS Naito,A., Orita,S., Wanaka,A., Sasaki,T., Sakaguchi,G., Maeda,M., Igarashi,H., Tohyama,M. and Takai,Y. TITLE Molecular cloning of mouse Doc2alpha and distribution of its mRNA in adult mouse brain JOURNAL Brain Res Mol Brain Res 44 (2), 198-204 (1997) PUBMED 9073161 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC124505.4. On Feb 8, 2019 this sequence version replaced XM_017321967.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR7345562.4256118.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849385, SAMN01164131 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-46 AC124505.4 188485-188530 47-494 AC124505.4 189183-189630 495-574 AC124505.4 189988-190067 575-649 AC124505.4 190250-190324 650-759 AC124505.4 190430-190539 760-886 AC124505.4 191702-191828 887-946 AC124505.4 191908-191967 947-1110 AC124505.4 192051-192214 1111-1192 AC124505.4 192305-192386 1193-1289 AC124505.4 192477-192573 1290-2104 AC124505.4 192659-193473 FEATURES Location/Qualifiers source 1..2104 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 69.25 cM" gene 1..2104 /gene="Doc2a" /note="double C2, alpha" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" exon 1..46 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 47..494 /gene="Doc2a" /inference="alignment:Splign:2.1.0" misc_feature 152..154 /gene="Doc2a" /note="upstream in-frame stop codon" CDS 218..1435 /gene="Doc2a" /note="doc2-alpha" /codon_start=1 /product="double C2-like domain-containing protein alpha" /protein_id="NP_001355286.1" /db_xref="CCDS:CCDS21847.1" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" /translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGGGTGCGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEIELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWNDCLHQPDTALERWHTLTSELPPAAGAYPLA"
misc_feature 218..499 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D and DYNLT1. /evidence=ECO:0000250" misc_feature 317..379 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 500..871 /gene="Doc2a" /note="C2 domain first repeat present in Rabphilin and Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035" /db_xref="CDD:176000" misc_feature order(590..592,608..610,773..775,779..781,797..799) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176000" misc_feature 875..1432 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D. /evidence=ECO:0000250" misc_feature 992..1390 /gene="Doc2a" /note="C2 domain second repeat present in Rabphilin and Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384" /db_xref="CDD:176030" misc_feature order(1076..1078,1094..1096,1256..1258,1262..1264, 1280..1282) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176030" exon 495..574 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 575..649 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 650..759 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 760..886 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 887..946 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 947..1110 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1111..1192 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1193..1289 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1290..2104 /gene="Doc2a" /inference="alignment:Splign:2.1.0" ORIGIN
ggggaacaccgggcgcctctcgcggaggtgcacgccaagttctcgggactgatctggcaacccacccagccctttgtgaagccaggcctcctgcctgcccaccagccagcgcagatcatcttttccctcgacacccaggaagggagggcagtgaggttcctacagaccccagccggccactccagctctacacccgtctcccagtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccgcttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]