2024-05-17 13:42:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001025225 1218 bp mRNA linear MAM 18-DEC-2022 DEFINITION Sus scrofa aurora kinase A (AURKA), mRNA. ACCESSION NM_001025225 VERSION NM_001025225.1 KEYWORDS RefSeq. SOURCE Sus scrofa (pig) ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae; Sus. REFERENCE 1 (bases 1 to 1218) AUTHORS Komrskova P, Susor A, Malik R, Prochazkova B, Liskova L, Supolikova J, Hladky S and Kubelka M. TITLE Aurora kinase A is not involved in CPEB1 phosphorylation and cyclin B1 mRNA polyadenylation during meiotic maturation of porcine oocytes JOURNAL PLoS One 9 (7), e101222 (2014) PUBMED 24983972 REMARK GeneRIF: Aurora kinase A is unlikely to be involved in CPEB1 activating phosphorylation and cyclin B1 mRNA polyadenylation during meiotic maturation of porcine oocytes. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1218) AUTHORS Nishimura Y, Kano K and Naito K. TITLE Porcine CPEB1 is involved in Cyclin B translation and meiotic resumption in porcine oocytes JOURNAL Anim Sci J 81 (4), 444-452 (2010) PUBMED 20662813 REFERENCE 3 (bases 1 to 1218) AUTHORS Nishimura Y, Endo T, Kano K and Naito K. TITLE Porcine Aurora A accelerates Cyclin B and Mos synthesis and promotes meiotic resumption of porcine oocytes JOURNAL Anim Reprod Sci 113 (1-4), 114-124 (2009) PUBMED 18614302 REMARK GeneRIF: Aurora A stimulates the protein synthesis and promotes the meiotic resumption. REFERENCE 4 (bases 1 to 1218) AUTHORS Yao LJ and Sun QY. TITLE Characterization of aurora-a in porcine oocytes and early embryos implies its functional roles in the regulation of meiotic maturation, fertilization and cleavage JOURNAL Zygote 13 (1), 23-30 (2005) PUBMED 15984158 REMARK GeneRIF: Aurora-A may be a multifunctional kinase that plays pivotal regulatory roles in microtubule assembly during porcine oocyte meiotic maturation, fertilization and early embryonic mitosis COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AB196773.1. ##Evidence-Data-START## Transcript exon combination :: AB196773.1, SRR5120059.330090.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA103886111, SAMEA103886112 [ECO:0000350] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1218 /organism="Sus scrofa" /mol_type="mRNA" /db_xref="taxon:9823" /chromosome="17" /map="17" gene 1..1218 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="aurora kinase A" /db_xref="GeneID:574063" CDS 1..1218 /gene="AURKA" /gene_synonym="ARK-1; STK6" /EC_number="2.7.11.1" /note="serine/threonine kinase 6; aurora-A; Serine/threonine-protein kinase 6; serine/threonine-protein kinase aurora-A; aurora 2; aurora-related kinase 1; aurora/IPL1-related kinase 1; serine/threonine-protein kinase 15; ipl1- and aurora-related kinase 1; serine/threonine-protein kinase Ayk1" /codon_start=1 /product="aurora kinase A" /protein_id="NP_001020396.1" /db_xref="GeneID:574063" /translation="
MDKCKENCISGLKTTVPPGDGPKRVPVTQHFPAQHLPSANSGQAQRVLCPSNSSQRLPSHTQKLVSSHKPVQNLKQKQSQATSGPRPVSRPLSNTQQSEQPQPAAPGNNPEKEAASKQKNEESKKRQWALEDFEIGRPLGKGKFGNVYLAREKQSKFILALKVLFKTQLEKAGVEHQLRREVEIQSHLRHPNILRLYGYFHDATRVYLILEYAPLGAVYRELRELQKLSKFDEQRTATYITELANALSYCHSKRVIHRDIKPENLLLGSAGELKIADFGWSVHAPSSRRTTLCGTLDYLPPEMIEGRMHDEKVDLWSLGVLCYEFLVGKPPFEANTYQETYKRISRVEFTFPDFAPEGARDLISRLLKHNPSHRPTLKEVLEHPWITANSKPASSHKKESTSKQP"
misc_feature 1..375 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 121..123 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:O14965; propagated from UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site" misc_feature 151..153 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:O14965; propagated from UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site" misc_feature 379..1161 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl21453" /db_xref="CDD:451246" misc_feature order(415..426,433..435,439..441,478..480,484..486, 580..582,628..639,775..777,787..792,796..798,826..831) /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature 847..888 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1); Region: Activation segment. /evidence=ECO:0000250|UniProtKB:O14965" misc_feature 868..870 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="Phosphothreonine. /evidence=ECO:0000250|UniProtKB:O14965; propagated from UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site" misc_feature 871..873 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="Phosphothreonine. /evidence=ECO:0000250|UniProtKB:O14965; propagated from UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site" misc_feature 1033..1035 /gene="AURKA" /gene_synonym="ARK-1; STK6" /note="Phosphoserine, by PKA and PAK. /evidence=ECO:0000250|UniProtKB:O14965; propagated from UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site" exon 1..39 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" exon 40..319 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" exon 320..374 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" exon 375..566 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" exon 567..714 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" exon 715..863 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" exon 864..1038 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" exon 1039..1218 /gene="AURKA" /gene_synonym="ARK-1; STK6" /inference="alignment:Splign:2.1.0" ORIGIN
atggacaaatgtaaagaaaactgcatttcggggcttaagaccacagttccacctggcgatggtccaaaacgggttccagtgacccagcactttccagctcagcatctgccgtctgcaaacagcggccaggcccagcgggtcttatgtccttcgaattcctcacagcgcctgccttcgcacacgcagaagctcgtctccagccataaaccagttcagaatctgaagcagaagcagtcgcaggcaaccagtggccctcgtcctgtctccaggcctctgagtaacacccagcagagtgagcagccccagccggcagcgcctggaaacaatcctgaaaaggaagcggcatcaaaacagaaaaatgaagaatcaaaaaaaaggcaatgggctttggaagattttgaaattggccgcccgctgggtaaaggaaagtttggtaatgtttatttagcaagagaaaaacaaagcaagtttatcctggctcttaaagtattgtttaaaactcagctggagaaggcaggagttgagcatcagctgagaagagaagtagaaatacagtcccaccttaggcatccaaatattctcagactgtatggttatttccatgacgctaccagagtttacctaatcctggaatacgcacctctcggagctgtctatagagaacttagagaacttcagaaactgtcaaagtttgatgagcagagaactgctacttatatcacagaattggcaaatgccctatcttactgtcactcaaagagagttattcacagagacattaagccagagaacctgctccttggatccgctggagagcttaagattgccgattttgggtggtcggtccatgccccgtcctccaggagaaccaccctctgcggcaccctggactacttgccccccgagatgatcgaaggccggatgcatgacgagaaggtggatctctggagcttgggggtgctttgctatgaattcctggttgggaagcccccctttgaggcaaacacgtaccaagagacctacaaaaggatatcccgggtggaattcaccttccctgactttgcgcccgagggagccagggacctcatctcaagactattgaagcacaaccccagccacaggcccaccctcaaggaggtgctcgaacacccctggatcaccgccaattccaagccagcaagtagtcacaaaaaagaatccaccagcaagcaaccctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]