2024-05-17 13:08:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001025223 936 bp mRNA linear MAM 18-FEB-2022 DEFINITION Sus scrofa speedy/RINGO cell cycle regulator family member A (SPDYA), mRNA. ACCESSION NM_001025223 VERSION NM_001025223.1 KEYWORDS RefSeq. SOURCE Sus scrofa (pig) ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae; Sus. REFERENCE 1 (bases 1 to 936) AUTHORS Kume S, Endo T, Nishimura Y, Kano K and Naito K. TITLE Porcine SPDYA2 (RINGO A2) stimulates CDC2 activity and accelerates meiotic maturation of porcine oocytes JOURNAL Biol. Reprod. 76 (3), 440-447 (2007) PUBMED 17151349 REMARK GeneRIF: pig SPDYA2 has important role in meiotic maturation of porcine oocytes and the rapid degradation of SPDY was necessary for the normal maturation of oocytes. COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AB196772.1. ##Evidence-Data-START## Transcript exon combination :: AB196772.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN03031526, SAMN04484993 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..936 /organism="Sus scrofa" /mol_type="mRNA" /db_xref="taxon:9823" /chromosome="3" /map="3" gene 1..936 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /note="speedy/RINGO cell cycle regulator family member A" /db_xref="GeneID:574061" /db_xref="VGNC:VGNC:93396" CDS 1..936 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /note="rapid inducer of G2/M progression in oocytes; speedy homolog 1; speedy homolog A" /codon_start=1 /product="speedy protein A" /protein_id="NP_001020394.1" /db_xref="GeneID:574061" /db_xref="VGNC:VGNC:93396" /translation="
MRHNQLCCETPPTVTVHVRSGSNRSHQPKKPINLKRPIFKDSWPASEKNAHNSNKSKRPKGPCLVIQRQEMTAFFKLFDDDLIQDFLWMDCCCKIADKYLLAMTFVYFKRAKFTINEHTRINFFIALYLANTVEEDEEESKYEIFPWALGKNWRKLFPDFLKLRDQLWDRIDYRAIVSRRCCEEVMAIAPTHYIWQRERSVHHSGAVRNYNRDEVQLPRGPSATPVDCSLCGKKGRYVRLGLSSSSSSSDTVEVVEKQSQESHNSFSMDIIVDPSQAYSYPQANDHQSNKEKKTNFMKKDKSMEWFTGSEE"
misc_feature 205..597 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /note="Cell cycle regulatory protein; Region: Spy1; pfam11357" /db_xref="CDD:431838" exon 1..235 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /inference="alignment:Splign:2.1.0" exon 236..294 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /inference="alignment:Splign:2.1.0" exon 295..380 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /inference="alignment:Splign:2.1.0" exon 381..552 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /inference="alignment:Splign:2.1.0" exon 553..847 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /inference="alignment:Splign:2.1.0" exon 848..936 /gene="SPDYA" /gene_synonym="RINGO; SPDY1" /inference="alignment:Splign:2.1.0" ORIGIN
atgagacataatcagctgtgttgcgagacaccacctactgtcactgtacatgtaagatcagggtcaaatagatcacatcagcccaaaaaacccattaatctgaagcgtcctatttttaaagatagttggccagcatctgaaaaaaatgcacataatagcaacaagtctaaacgccccaaaggaccctgtctagttatacagcgtcaggaaatgactgctttctttaaattatttgatgatgatttaattcaagatttcttgtggatggactgctgctgtaaaattgcagacaagtatcttttagctatgacctttgtttatttcaagagagccaaatttactataaacgagcataccaggataaatttctttattgctctgtatctggctaatacagttgaagaagatgaagaagaatccaaatatgaaatttttccatgggctttagggaaaaactggagaaaattattccctgatttcttaaagttaagggaccaactctgggatagaattgactatagagctattgtaagcaggcgatgctgtgaggaggttatggccattgctccaacacattatatatggcaacgagaacgctctgtgcatcacagtggagctgttagaaactacaacagagatgaagttcaattgccccggggacctagtgccacgccagtagattgttcactctgtggtaaaaaaggaagatatgttagactgggattgtcttcatcatcttcatccagcgatacagtagaggtggtggagaaacagtctcaagaatcacacaattcattctcaatggacataatagttgatccttctcaagcttatagctatcctcaagccaatgaccatcaatcaaacaaagaaaagaaaactaatttcatgaagaaagacaaatctatggagtggtttacaggaagtgaagaatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]